ID: 1121457243

View in Genome Browser
Species Human (GRCh38)
Location 14:94046268-94046290
Sequence CCTCTGGTGTCTCTTTACCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457235_1121457243 10 Left 1121457235 14:94046235-94046257 CCTATGCTGACATTCCATTGTAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1121457243 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 1
3: 24
4: 251
1121457233_1121457243 15 Left 1121457233 14:94046230-94046252 CCCTGCCTATGCTGACATTCCAT 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1121457243 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 1
3: 24
4: 251
1121457234_1121457243 14 Left 1121457234 14:94046231-94046253 CCTGCCTATGCTGACATTCCATT 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1121457243 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 1
3: 24
4: 251
1121457239_1121457243 -4 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457243 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 1
3: 24
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457243 Original CRISPR CCTCTGGTGTCTCTTTACCA GGG Exonic