ID: 1121457244

View in Genome Browser
Species Human (GRCh38)
Location 14:94046269-94046291
Sequence CTCTGGTGTCTCTTTACCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457239_1121457244 -3 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457244 14:94046269-94046291 CTCTGGTGTCTCTTTACCAGGGG 0: 1
1: 0
2: 3
3: 33
4: 269
1121457233_1121457244 16 Left 1121457233 14:94046230-94046252 CCCTGCCTATGCTGACATTCCAT 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1121457244 14:94046269-94046291 CTCTGGTGTCTCTTTACCAGGGG 0: 1
1: 0
2: 3
3: 33
4: 269
1121457234_1121457244 15 Left 1121457234 14:94046231-94046253 CCTGCCTATGCTGACATTCCATT 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1121457244 14:94046269-94046291 CTCTGGTGTCTCTTTACCAGGGG 0: 1
1: 0
2: 3
3: 33
4: 269
1121457235_1121457244 11 Left 1121457235 14:94046235-94046257 CCTATGCTGACATTCCATTGTAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1121457244 14:94046269-94046291 CTCTGGTGTCTCTTTACCAGGGG 0: 1
1: 0
2: 3
3: 33
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457244 Original CRISPR CTCTGGTGTCTCTTTACCAG GGG Exonic