ID: 1121457249

View in Genome Browser
Species Human (GRCh38)
Location 14:94046288-94046310
Sequence GGGGCAGTGCCTCTCTGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457235_1121457249 30 Left 1121457235 14:94046235-94046257 CCTATGCTGACATTCCATTGTAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1121457249 14:94046288-94046310 GGGGCAGTGCCTCTCTGCGGGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1121457239_1121457249 16 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457249 14:94046288-94046310 GGGGCAGTGCCTCTCTGCGGGGG 0: 1
1: 0
2: 0
3: 22
4: 207
1121457242_1121457249 -3 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457249 14:94046288-94046310 GGGGCAGTGCCTCTCTGCGGGGG 0: 1
1: 0
2: 0
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457249 Original CRISPR GGGGCAGTGCCTCTCTGCGG GGG Exonic