ID: 1121457250

View in Genome Browser
Species Human (GRCh38)
Location 14:94046291-94046313
Sequence GCAGTGCCTCTCTGCGGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457242_1121457250 0 Left 1121457242 14:94046268-94046290 CCTCTGGTGTCTCTTTACCAGGG 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1121457250 14:94046291-94046313 GCAGTGCCTCTCTGCGGGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 175
1121457239_1121457250 19 Left 1121457239 14:94046249-94046271 CCATTGTAGAAAAATGGGGCCTC 0: 1
1: 0
2: 0
3: 16
4: 106
Right 1121457250 14:94046291-94046313 GCAGTGCCTCTCTGCGGGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457250 Original CRISPR GCAGTGCCTCTCTGCGGGGG AGG Exonic