ID: 1121457374

View in Genome Browser
Species Human (GRCh38)
Location 14:94047022-94047044
Sequence GTCCTGAGGCAGCAAGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 291}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121457374_1121457382 6 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457382 14:94047051-94047073 GATTCCATCTGTGGGCTGGCCGG 0: 1
1: 0
2: 4
3: 21
4: 212
1121457374_1121457385 23 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457385 14:94047068-94047090 GGCCGGCAAGATGGCACCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 150
1121457374_1121457381 2 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457381 14:94047047-94047069 TCAAGATTCCATCTGTGGGCTGG 0: 1
1: 0
2: 10
3: 45
4: 294
1121457374_1121457386 24 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457386 14:94047069-94047091 GCCGGCAAGATGGCACCAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1121457374_1121457379 -2 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457379 14:94047043-94047065 ACCTTCAAGATTCCATCTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 127
1121457374_1121457384 14 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457384 14:94047059-94047081 CTGTGGGCTGGCCGGCAAGATGG 0: 1
1: 0
2: 0
3: 16
4: 197
1121457374_1121457388 25 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457388 14:94047070-94047092 CCGGCAAGATGGCACCAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 114
1121457374_1121457378 -3 Left 1121457374 14:94047022-94047044 CCCTCACCTTGCTGCCTCAGGAC 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1121457378 14:94047042-94047064 GACCTTCAAGATTCCATCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121457374 Original CRISPR GTCCTGAGGCAGCAAGGTGA GGG (reversed) Exonic
900579639 1:3402688-3402710 GCCCTGAGGCACCGTGGTGAGGG + Intronic
900960347 1:5915117-5915139 GTCCTGAGGGAGGAGGGAGAGGG + Intronic
901741374 1:11344182-11344204 GTCCTCAGGGAGGCAGGTGAGGG + Intergenic
902681398 1:18046343-18046365 GCCCTGGGGCAGCAAGTGGAGGG - Intergenic
904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG + Intergenic
904926867 1:34056315-34056337 GTCTTGAGGCAGAAACATGAAGG - Intronic
905480999 1:38261978-38262000 GTCCTGATACAGCAAGGCGGGGG + Intergenic
906671058 1:47655291-47655313 GCCTTGAGGCAGCAGGGTGAGGG + Intergenic
907667362 1:56445092-56445114 GACATGAGCCAGGAAGGTGATGG - Intergenic
911512791 1:98827897-98827919 GTGCTGAGGCGGCAAGCTGCTGG - Intergenic
912471466 1:109910177-109910199 GTCCTGTGACAGCAAGCTGGGGG - Intergenic
913453115 1:119006252-119006274 ATGCTAAGGCAGCAAGGAGAGGG + Intergenic
916987501 1:170207465-170207487 GTCCTGAGGCTGCATGGAGCAGG - Intergenic
918261614 1:182801371-182801393 GGCCTGAGGGAGAGAGGTGAGGG + Intronic
918266619 1:182848091-182848113 GTTTTGAGGCAGAAAGATGAGGG - Intronic
919101264 1:193099966-193099988 AACCTGAGGCAGCATGGTGGAGG - Intronic
920206625 1:204296840-204296862 GTACTGAGGCTGGAAGGAGAAGG - Intronic
920386203 1:205571659-205571681 GCCCAGAGTCAGCAAGGTGGTGG - Intronic
920791881 1:209100781-209100803 GGCCTGAGGCAGCATGTTGGTGG + Intergenic
923193714 1:231644244-231644266 GTGGTGAGCAAGCAAGGTGATGG - Intronic
923229682 1:231973414-231973436 GTCTCGAAGCAGCAAGTTGAGGG + Intronic
1063456564 10:6186908-6186930 CTACTGAGGAAGCAAGGAGAAGG - Intronic
1063792203 10:9464651-9464673 GTGCTTAGGCAGCAAGGATATGG + Intergenic
1064846881 10:19665584-19665606 GTCTTGGGGGAGGAAGGTGAAGG - Intronic
1065830263 10:29608638-29608660 GGGCTGAGGCAGCAGGGTGCTGG - Intronic
1069416764 10:68207508-68207530 GGCCCGCGGCAGCAAGGAGATGG - Intronic
1070381342 10:75883083-75883105 GTGCTGAGCTAGCAAGGAGAAGG - Intronic
1070808565 10:79285743-79285765 CTCCTGAGGCAGAAGGGAGAAGG + Intronic
1074909925 10:117899092-117899114 GTCCTCAGTGAGCAAGGTCAGGG + Intergenic
1075515099 10:123102309-123102331 TTCCGGAAGCAGCAAGGTAATGG + Intergenic
1076727670 10:132421133-132421155 GACCTGGGGCAGGAAGGGGAGGG - Intergenic
1077669373 11:4143846-4143868 CTCATGAGGCAGGATGGTGAAGG - Intergenic
1078792778 11:14561243-14561265 GTTTTGAGTCAGCATGGTGAAGG - Intronic
1078900173 11:15634700-15634722 GTCCTGCGGCAGCCAGGGAATGG - Intergenic
1081752931 11:45524900-45524922 GTCCTGGGGCAGGAGTGTGATGG - Intergenic
1081765042 11:45604540-45604562 GCCATGTGGCAGCAAGGAGAGGG + Intergenic
1084563332 11:69916097-69916119 GTCCTCAGGCAGCCAGGAGCAGG + Intergenic
1084655187 11:70510887-70510909 GCTCTGAGGCAGCAAGGAGTAGG - Intronic
1085304098 11:75475518-75475540 TTCCTGAGGCAGCTGGGTGAGGG - Intronic
1085403108 11:76246271-76246293 GTCCTCAGGGAGCTCGGTGAAGG - Intergenic
1085745219 11:79109341-79109363 GGGCAGAGGCAGCCAGGTGAGGG + Intronic
1088098372 11:106126334-106126356 GTCCTGAGGGAGCTACATGAAGG + Intergenic
1088626794 11:111735501-111735523 GACCCGCGGCAGCAAGGTGTGGG + Intronic
1090422990 11:126588509-126588531 GCCCTGAGGCAGGGAGGGGAAGG + Intronic
1091738045 12:2939507-2939529 GTCCTGGGGCAGGGAGGGGAAGG - Intronic
1092262344 12:6959459-6959481 GCCCTGAGACAGCAGGGTGCGGG - Intronic
1093890720 12:24517192-24517214 GTCAAGAGGCAGCAAGGGAAAGG - Intergenic
1094090681 12:26645598-26645620 GCCCAGAGGCAGCATGGTGCTGG + Intronic
1096148332 12:49294238-49294260 TTCCTGAGGTAGGAAGGGGAGGG - Exonic
1097105081 12:56617470-56617492 GTCCTGAGGCAGCAGGTGCAGGG + Exonic
1097345478 12:58487494-58487516 GGCCTCAGGCAGCAAGCTGTTGG + Intergenic
1097891483 12:64781271-64781293 TACCTGCGGCAGAAAGGTGAGGG + Intronic
1098622980 12:72627347-72627369 TTCCTATGGCAGAAAGGTGAAGG - Intronic
1099498192 12:83378528-83378550 GCCCAGAGGCAGCAAGGGCAAGG + Intergenic
1099735124 12:86557502-86557524 GTCCTCAGGCACCATGGTGGTGG - Intronic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1100335686 12:93626876-93626898 GTCAAGTGGGAGCAAGGTGAGGG - Intergenic
1100981185 12:100164037-100164059 GCCCAGCGGCAGCAGGGTGAGGG - Intergenic
1102046853 12:109834756-109834778 GCACTGAGGCACAAAGGTGAAGG - Intergenic
1102652321 12:114450876-114450898 GGGCTGGGGCAGCAAGGGGAGGG + Intergenic
1102744168 12:115235152-115235174 GTCCTGGGGCAGCAAGTTGATGG - Intergenic
1103511367 12:121476931-121476953 CTCCTGAGCCAGCAGTGTGAGGG - Intronic
1103631638 12:122266300-122266322 GTGCGCAGGAAGCAAGGTGAGGG - Exonic
1103859974 12:124004341-124004363 GTCCTGAGGGAGCAAAGAAAAGG + Intronic
1104445560 12:128830256-128830278 GGCCTGATGCACAAAGGTGAGGG - Intergenic
1105871182 13:24507175-24507197 GTCCTGCGCCTGCAAGCTGAAGG + Intronic
1105936110 13:25100924-25100946 GTCCTGATGCAGAAAGGAGCTGG - Intergenic
1105996927 13:25681486-25681508 GTCCTGACGCTGCAGGGTTAGGG + Intronic
1106461016 13:29968967-29968989 GTCCTGAGGGAGCAAAGACAAGG + Intergenic
1107989832 13:45810062-45810084 GCCCTGAGGCAGCGACCTGAAGG + Intronic
1108557088 13:51604276-51604298 TTTCTGAGGCGGCAAGATGAGGG - Intronic
1108616105 13:52133891-52133913 GTCCTCAGCCAGCAAGCTTACGG - Intronic
1109681625 13:65758702-65758724 GTGCTGAGGTAGCAAGGGGTTGG - Intergenic
1110006443 13:70276836-70276858 GACCTGGGGAAGCAAGGTTAAGG + Intergenic
1113853979 13:113434025-113434047 GTCCTGCAGCAGAAAGGAGATGG + Intronic
1113948735 13:114059542-114059564 GTCCTGAGGCTGAGAGATGAGGG - Intronic
1115648348 14:35385434-35385456 GTGATGAGGCTGCAGGGTGAGGG - Intergenic
1118947079 14:70398480-70398502 GGGCTGAGGCAGCAAGGGGCTGG + Intronic
1119579823 14:75767807-75767829 GTCCAGAGCCAGGAAGATGAAGG + Intronic
1120822547 14:88926236-88926258 GTCCTGAGGGAGGAGGGTGGAGG + Intergenic
1121457374 14:94047022-94047044 GTCCTGAGGCAGCAAGGTGAGGG - Exonic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1121819308 14:96953510-96953532 GGCATGAGGAAGCAAGGAGAAGG - Intergenic
1123696885 15:22884941-22884963 GTCCTGAAGCTGCACGGGGATGG + Intronic
1123798573 15:23798207-23798229 GGCCTGAGGAAGGAAGCTGATGG - Intergenic
1125282004 15:38052123-38052145 GTCCTGTGGCAGGAAGGTACTGG - Intergenic
1125353230 15:38789459-38789481 GCCCTGAGAGAGCATGGTGAAGG + Intergenic
1127141737 15:55984991-55985013 TTTCTGAGACAGCAAGGGGATGG + Intronic
1127284957 15:57524425-57524447 ATCCTGAGTCAGCCAGGTGTGGG - Intronic
1127599619 15:60522471-60522493 AGGCTGAGGCAGGAAGGTGATGG + Intronic
1129530024 15:76258294-76258316 GTGCTGAGCCAGCAAGAGGAAGG - Intronic
1129699500 15:77759427-77759449 GGCCTGAGGCAGCAAGCTGTGGG + Intronic
1132045512 15:98559920-98559942 GACCTCAGGCTCCAAGGTGAGGG - Intergenic
1132586828 16:709228-709250 GTGCTGAGGCATCAAGGCAAGGG - Intronic
1134089572 16:11384381-11384403 GTCCTGAGGCAGCAGGGCTGGGG - Intronic
1137343831 16:47636646-47636668 GGGCTGAGGCAGCAGGGGGATGG - Intronic
1137404830 16:48181134-48181156 GTCCTGAAGCAGCAGCGGGAGGG + Intronic
1138456935 16:57126470-57126492 GTCCCCAGGAAGCAAGGTCATGG - Intronic
1139327440 16:66163385-66163407 GTCCTCAGGCAGAGAGGTGCTGG + Intergenic
1139518163 16:67464083-67464105 GCCCTGAGGCTGCCAGGTCATGG - Intronic
1139593705 16:67946666-67946688 GCCCAGAGGCAGGAAGCTGATGG - Intronic
1141134746 16:81457967-81457989 GTCCTGAGTCATCAGGGCGAAGG - Intronic
1144754002 17:17668567-17668589 GTCCTGAGGCAGGAGTGTGCCGG - Intergenic
1144874302 17:18389247-18389269 GTCCTGAGGCAGCAGGGCTGTGG - Exonic
1144950030 17:18989065-18989087 GTCCCTTGGCAGCAAGGGGAGGG + Intronic
1145157926 17:20555171-20555193 GTCCTGAGGCAGCAGGGCTGTGG + Intergenic
1147511738 17:41075511-41075533 GTCCTGAGAAAGTAAGATGAGGG - Intergenic
1148491879 17:48028556-48028578 GTCCTGGGTCAGGGAGGTGAAGG + Intronic
1149014438 17:51891676-51891698 GTCAGGAGGCAGGCAGGTGAGGG + Intronic
1150301797 17:64053309-64053331 GGTCTGCTGCAGCAAGGTGATGG + Exonic
1151444350 17:74153477-74153499 TTCCCTAGGCAGCAAGGTCAGGG + Intergenic
1151669718 17:75565351-75565373 GGCCTGAGGCCGAAAGGTGAGGG + Intronic
1151780823 17:76244052-76244074 TTCCTGAGGCAGCAGGGTTTGGG + Intergenic
1151875519 17:76865964-76865986 GTCCTCAGGCAGAGAGTTGAAGG + Intergenic
1151898509 17:76996637-76996659 GTCCAGAGGCTGCAATGGGAAGG + Intergenic
1152027889 17:77823539-77823561 GGCCTAAGGAAGCAAGGGGAGGG + Intergenic
1152205131 17:78970565-78970587 GTGCTGAGGTGGCAAGGTCAGGG - Intergenic
1152314797 17:79573878-79573900 GTCCTGAGCCAGGGAGGAGAAGG - Intergenic
1154318522 18:13325550-13325572 GTCCACAGGAAGCAAGGAGAGGG - Intronic
1156511263 18:37638823-37638845 GTCCTGAGTCAGAAAAGTGTTGG + Intergenic
1157187701 18:45554484-45554506 CTCCTGGGGCTGCAAGGTGGGGG + Intronic
1157453895 18:47809340-47809362 GGCCAGAGCAAGCAAGGTGAGGG + Exonic
1160725637 19:616728-616750 GAACTGAGGCACCGAGGTGAAGG - Exonic
1160732050 19:645763-645785 GTCCTCAGGCAGTGAGGTGGGGG + Intergenic
1161005279 19:1932645-1932667 GCCCAGAGGCAGCCAGGTGAGGG - Intergenic
1161144895 19:2671588-2671610 GCCCTGAGGCGGGAAGGTGACGG + Intronic
1161407399 19:4098259-4098281 GTCCAGAGGCAGGAAGGGGATGG + Intronic
1163679498 19:18672487-18672509 GTGCTGGGGCGGGAAGGTGAGGG + Intergenic
1164799356 19:31063273-31063295 GACCTAAGGCAGGAAGCTGAAGG + Intergenic
1166546051 19:43635477-43635499 GTCCTGAGGGAGGAAGGGGCTGG - Intronic
1167291562 19:48627885-48627907 GTCCTAAGGGAGCAAAGTGGTGG + Intronic
1167507082 19:49876533-49876555 GTCCTGAGGCAGCGGGGCGCTGG - Intronic
1167784679 19:51627455-51627477 GTCCTGCTGCTGCAAGGTCAGGG - Exonic
1168507206 19:56946291-56946313 CTCCTGAGGCAGCAAGGGGGAGG - Intergenic
929396357 2:41527674-41527696 GTCTTCAGCCAGCAAAGTGAAGG - Intergenic
930035106 2:47080307-47080329 GTCCTGGGGGAGCTAGGAGAAGG + Intronic
932781644 2:74562247-74562269 GTCCTCAGGTAGCAGGGGGAAGG + Exonic
933757596 2:85652221-85652243 GTCCTGAGGTAACACTGTGAAGG + Intergenic
933777259 2:85778732-85778754 TTCGAGAGGCAGCAGGGTGATGG + Intronic
934737808 2:96698798-96698820 GTCCTGGGGCTGCAGGTTGATGG - Intergenic
936376973 2:111949023-111949045 GTCCTGAGGCAGGAAGGAACAGG - Intronic
937201086 2:120204926-120204948 GTGCTGAGGCCGCAGGGTAAGGG + Intergenic
938403860 2:131016294-131016316 GTTCTGAGGATGCAATGTGAAGG - Intronic
938406791 2:131037263-131037285 GTCCTGAGCAAGCAAGTTCAGGG - Intronic
941025774 2:160454593-160454615 GTCCTGAGGCAGGAAGGATCTGG + Intronic
941489866 2:166129977-166129999 GTCCTGAGTCCCCATGGTGAGGG - Intergenic
942585127 2:177466638-177466660 GGGCTGAGGCAGCAGGGTGCTGG + Intronic
945833388 2:214811071-214811093 GCCATGAGGCAGCAAGGTGCAGG - Intergenic
946084164 2:217154357-217154379 GACTTGAGGCAACAAGGTCAAGG - Intergenic
947049003 2:226021138-226021160 GCCATGAGGCAACAGGGTGAGGG - Intergenic
948035805 2:234857532-234857554 GTTCTCAGGGAGCAAGGGGAGGG + Intergenic
948107583 2:235427832-235427854 ATTCTGAGGGAGCAAGCTGACGG - Intergenic
948243861 2:236461957-236461979 GTAGTGGGGCAGCACGGTGAGGG + Intronic
1171096222 20:22334659-22334681 TTCCAGAGGAAGCAAGGTGGTGG - Intergenic
1171226233 20:23444176-23444198 CTCCTGAGGCACCTGGGTGAAGG + Intronic
1171330150 20:24330321-24330343 GCCCTGAGGCAGCACAGTGAAGG + Intergenic
1172801152 20:37577127-37577149 GTCCTGGGTCAGCAGGCTGAAGG - Intergenic
1173120723 20:40286918-40286940 GACAGGAGGCAGCATGGTGAAGG - Intergenic
1173413627 20:42837262-42837284 TGTCTGAGGCAGCAAGGTGCTGG - Intronic
1174417504 20:50377127-50377149 GCCCTGAGGCAGCACAGTCAGGG + Intergenic
1174663381 20:52235133-52235155 GACCAGAGGTAGCATGGTGAGGG + Intergenic
1175044451 20:56091797-56091819 GTCCTGATGGAGGTAGGTGAGGG - Intergenic
1175395444 20:58655997-58656019 GCCCTGAGGCATGAACGTGATGG - Intronic
1175532822 20:59685666-59685688 GTCCTGAGACAGCACGGTAGAGG - Intronic
1175997751 20:62819018-62819040 TTCCTGGGCCAGCAAGGTGTGGG + Intronic
1176973333 21:15290346-15290368 GGCCTGAGGCAGCAGGGGGCTGG + Intergenic
1178604202 21:34021147-34021169 TTCTGGAGGCAGGAAGGTGAAGG + Intergenic
1179321936 21:40300539-40300561 GGCCTGAGACAGCAAAGAGAGGG - Intronic
1179654033 21:42834147-42834169 GTCCTGGGACAGGAAGATGATGG + Intergenic
1180025816 21:45161487-45161509 GTGCCGAGGCAGCAGGGTGCTGG - Intronic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1181990783 22:26835220-26835242 GCCCTGTGGCAGCAGGGTCACGG + Intergenic
1182257457 22:29049359-29049381 GTCCATGGTCAGCAAGGTGACGG - Exonic
1182353850 22:29713375-29713397 CTCCTGGGGCAGCTGGGTGAGGG - Intergenic
1182554648 22:31122715-31122737 GGCCTACGGCAGAAAGGTGAAGG + Intronic
1183401431 22:37607279-37607301 GTCGTGACGCCACAAGGTGAGGG + Intergenic
1183403890 22:37620445-37620467 CTTCTGAGCCAGCAAGGTCATGG + Intronic
1183481286 22:38066947-38066969 GTGCTGGGGCACCAAGGGGAGGG - Intronic
1183652869 22:39169014-39169036 GGTTTGAGGCAGGAAGGTGAGGG - Intergenic
1184721755 22:46318699-46318721 GTCCTGGGGCAGGAAGGCGTGGG + Intronic
1185080909 22:48708854-48708876 CTGCTCAGGCAGCAAGGGGAAGG - Intronic
949895840 3:8767192-8767214 ATTCTGAGGCAGCAAGATAAGGG + Intronic
949928131 3:9058066-9058088 CACCTGAGACAGCAAGATGAGGG + Intronic
950271595 3:11620399-11620421 CCCCTGAGCCAGCAGGGTGAGGG + Intronic
951427899 3:22569874-22569896 GTCCTCAGGCAACAGGGTGCTGG + Intergenic
952141134 3:30480334-30480356 GTCCTGAGGCTGCATGGAGCAGG - Intergenic
952278517 3:31901411-31901433 GTTCTGAGGCAGGAAAGTGGGGG - Intronic
953216324 3:40922263-40922285 GTCCTGAGGTGGCAAAGGGAGGG + Intergenic
953903171 3:46854678-46854700 GTCCTGAGTCAGAGAGGTCAGGG - Intergenic
954807397 3:53228547-53228569 GGTCTGAGGCTGCAAGGTGGTGG - Intronic
955305094 3:57822616-57822638 ATCCTGTAGCAGCCAGGTGATGG + Intronic
955578014 3:60387586-60387608 GAGCAGAGGCAGAAAGGTGAGGG - Intronic
955993078 3:64649342-64649364 GCTCAGAGGCAGCAAGGTTACGG - Intronic
959664413 3:108905145-108905167 GGCATGAGGCAGCAGAGTGACGG + Intergenic
960029364 3:113041951-113041973 GTCCTGAAGGAGACAGGTGATGG + Intergenic
960409586 3:117306467-117306489 GCCCTGAGGCAGGTAGGTGATGG + Intergenic
961744756 3:129057416-129057438 GCCCTGAGGCAGGAAAGTGCTGG + Intergenic
962651221 3:137494706-137494728 GTTCTGAGGCAGGAATGTGCTGG - Intergenic
962740979 3:138362389-138362411 GGCCTGAGGCAGAAAGTTGTGGG - Intronic
963224511 3:142848295-142848317 GTCCAGTGGCAACAAGATGATGG - Exonic
963406137 3:144866468-144866490 GACCTCAGGAAGCAAGGAGAAGG - Intergenic
964524447 3:157603394-157603416 GCCTTGAGGCAGCAGGTTGATGG - Intronic
965289871 3:166865305-166865327 GGCCTGAGGCAGCAGGGAGCTGG - Intergenic
965907151 3:173723028-173723050 GTCCTGAAGCTACAAGGGGACGG + Intronic
966661235 3:182417351-182417373 GCCCTGAGGTAGGATGGTGAAGG - Intergenic
968451737 4:679158-679180 GCCCTGAAGCTGCAAGGTGATGG + Intronic
968510308 4:992643-992665 GTCCCGAGGCAGCACCGAGAGGG + Intronic
968538734 4:1151385-1151407 GTGCTGAGGCAGCAGGGGGCTGG + Intergenic
968657305 4:1784162-1784184 GTCCTGGTGCAGCAAGCTGGGGG + Intergenic
968731200 4:2270177-2270199 GTCCTGAGGAAGGATGGTGAGGG + Exonic
968882483 4:3308588-3308610 GGCCTTAGGCAGCCAGGTGGTGG - Intronic
969480489 4:7444502-7444524 GTCCTGTGGCAGCTGGGTGCAGG + Intronic
969978296 4:11127406-11127428 GTCCTGAGGCATCAATGGGCAGG - Intergenic
972795842 4:42418606-42418628 GTCATGAGGCAGCAAGGTTTGGG + Intronic
975637114 4:76461643-76461665 GTTCTGAGACAGCAGTGTGAAGG + Intronic
977418741 4:96768528-96768550 GTCCTGAGGCAGTAAGATAGAGG + Intergenic
978499552 4:109394193-109394215 GTCCTCAGGCAGAAAGATGTAGG + Intergenic
980078465 4:128319154-128319176 GACCTGAGGCAGCCAGGAAATGG - Intergenic
980962192 4:139486366-139486388 TTCATGATGAAGCAAGGTGAAGG - Intergenic
982068390 4:151674044-151674066 GTTCTGAGGCACCAGGCTGAAGG - Intronic
982147916 4:152417824-152417846 GCCCAGAGGCAGCAAGGCCAGGG - Intronic
983115132 4:163806100-163806122 GGCCTGAAGCATCAAGGTGTAGG + Intronic
985986575 5:3521424-3521446 GTCCCAAGGCAGCCAGGTGGTGG + Intergenic
986356658 5:6935408-6935430 GTTCTGGGGAAACAAGGTGAAGG - Intergenic
989145512 5:38245702-38245724 GTCCTGAAGCTGGAAGGTGAAGG - Intergenic
989343133 5:40399667-40399689 GTCCTGAGACAAAAATGTGAAGG + Intergenic
990537177 5:56734160-56734182 GTCCTGGGGCAGAAAGGAGCAGG - Intergenic
991359360 5:65803384-65803406 GGGCTGAGGCAGCAAGGGGCTGG + Intronic
991562463 5:67968400-67968422 CACCTGAGATAGCAAGGTGAAGG - Intergenic
994632589 5:102304693-102304715 GTGCTGAGAAAGGAAGGTGATGG - Intergenic
995446928 5:112254904-112254926 CTCCTAGTGCAGCAAGGTGAAGG - Intronic
997353635 5:133248367-133248389 GTCCTGAGCCAACAAGGCTAAGG + Intronic
998369233 5:141650599-141650621 GGCCCGGGGCAGTAAGGTGAGGG - Intronic
1000268278 5:159658634-159658656 GTAATGAGGCAGGAAGGAGAGGG + Intergenic
1001487159 5:172127881-172127903 GTTCTGAGCCAGCAAGGTCCAGG - Intronic
1001492093 5:172163089-172163111 CTCCTGTGGCCTCAAGGTGATGG - Intronic
1001901426 5:175433726-175433748 GTCCAGGGGCAATAAGGTGAGGG - Intergenic
1002093721 5:176818810-176818832 GTCAGGAGGCAGCATGGGGATGG - Intronic
1002200744 5:177526479-177526501 GTGCTGGGGGAGCGAGGTGAAGG - Intronic
1002535710 5:179874321-179874343 GGGCTGAGGCAGCAGGCTGAAGG + Intronic
1002837135 6:874461-874483 GTCCTCAGGCAGCAAAGCAAAGG - Intergenic
1003438924 6:6121895-6121917 GAGCTGAGGCAGCAAGGGGCTGG - Intergenic
1003962252 6:11219626-11219648 GTCCTAAGGCAGGCAGCTGAGGG + Intronic
1004370659 6:15049452-15049474 TACCTCAGGGAGCAAGGTGAAGG + Intergenic
1005348591 6:24912780-24912802 TTCCTGAGTCAGGAAGGTGATGG - Intronic
1005920557 6:30397335-30397357 GTCCTGTGGCAGCAAGGATTTGG - Intergenic
1009554789 6:65148964-65148986 GTCCTGAGGCTGCACGGAGTGGG + Intronic
1011283874 6:85704107-85704129 GGCCTCAGGGTGCAAGGTGAAGG - Intergenic
1011944213 6:92880771-92880793 GTCCTGAGTCCCTAAGGTGAGGG + Intergenic
1012468609 6:99544219-99544241 GGCCTGAAGCTGCAAGATGATGG - Intronic
1017757724 6:157543794-157543816 GTCCTGAGGTAGGAAGGAGGGGG + Intronic
1018060007 6:160082829-160082851 CTCCTGAGGCAGCATGGGGAAGG + Intronic
1019150902 6:170005001-170005023 GTCCTGAGGCAGCACAGAGCAGG + Intergenic
1019499246 7:1356091-1356113 GGCGGGAGGCAGCAAGGAGATGG - Intergenic
1019651903 7:2164320-2164342 CTCTGGAGGCAGCCAGGTGAAGG + Intronic
1019661045 7:2224225-2224247 GTCTGGAGGCAGCATGCTGATGG - Intronic
1019716466 7:2541620-2541642 GTGCTGGGGCAGCAAGGGGTGGG + Intronic
1021403469 7:20237173-20237195 GACCTGAGGCAGGGAGGTGGTGG + Intergenic
1022315791 7:29244441-29244463 GTCTTAAGGCAGCAAGGTGAGGG + Intronic
1022534163 7:31085492-31085514 GTCCTGGGGAACCAAGGGGATGG - Intronic
1022908752 7:34880083-34880105 GTCCTCAGGCTGGAATGTGATGG - Intergenic
1024159054 7:46655792-46655814 GTCATGAGACAGCTAGGTGGTGG - Intergenic
1024510398 7:50199547-50199569 GTCCTGGAGCAGCAAGGAGCAGG + Intergenic
1024752429 7:52483228-52483250 ATCCTAAGGCAGAAAGGAGAGGG + Intergenic
1025253139 7:57365410-57365432 GGCCTGAGGCAGCACAGTCAGGG - Intergenic
1027044321 7:74981516-74981538 GTCCTGAGGCCTCAGGGTCAGGG - Intronic
1027079320 7:75220842-75220864 GTCCTGAGGCCTCAGGGTCAGGG + Intergenic
1028032399 7:85932765-85932787 GTCCTGAGGCAGCACAGAGTGGG - Intergenic
1029380206 7:100209354-100209376 GTCCTGAGGCCACGAGGGGATGG + Intronic
1029899244 7:104022245-104022267 GGCCTGAGGCTGCAAGGGGCTGG - Intergenic
1030271069 7:107668789-107668811 GTGAGGACGCAGCAAGGTGACGG - Intronic
1030570220 7:111213277-111213299 GGGCTGAGGCAGCAGGGTGCTGG - Intronic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1031976826 7:128099265-128099287 GCCCTCAAGCAGCAGGGTGAGGG - Intergenic
1033353118 7:140578362-140578384 CTCCTGAGGCAGTAAAGTCAGGG - Intronic
1033434865 7:141324007-141324029 GTCCTGAGGCATCGAGATGCTGG + Intronic
1035244430 7:157553059-157553081 CTCCTGAGACAGAAAGCTGAGGG - Intronic
1035412406 7:158655698-158655720 GTCATGAGGCAGGGAGGGGACGG - Intronic
1035609075 8:948431-948453 GGCCTGAGGAAGGAAGGGGAAGG - Intergenic
1035683217 8:1503942-1503964 GACCTGAAGCAGCCAGGTGCAGG + Intronic
1036634419 8:10539117-10539139 GTCCAGGGGCTGAAAGGTGAAGG + Intronic
1038324894 8:26565551-26565573 GTCATGGGTCAGCAAAGTGAAGG + Intronic
1040598783 8:48864644-48864666 GTACTGGCGGAGCAAGGTGAAGG + Intergenic
1041464363 8:58144120-58144142 GTCCTCAGGCACAAAGCTGAAGG + Intronic
1042210974 8:66380127-66380149 TTACTGAGGCAGCAAGATGGAGG - Intergenic
1042407579 8:68422991-68423013 GTCCTGAGGCAGCACAGAGCAGG + Intronic
1044820514 8:96153042-96153064 GTGCTGAGGCCCCGAGGTGAGGG - Intronic
1045324768 8:101109909-101109931 GTCCTGAGGGGGCAGGGTGGAGG + Intergenic
1048049885 8:130806769-130806791 GCCCTCAGGCACCCAGGTGAGGG - Intronic
1048317728 8:133374697-133374719 CTCCTGGGGCAACGAGGTGAGGG + Intergenic
1048490192 8:134885111-134885133 GTCTGGAGGCAGCAGGGTGTGGG + Intergenic
1049214659 8:141402160-141402182 GGTCTGAGGCTGCAAGGTGTGGG + Intronic
1049595899 8:143483252-143483274 CTCCCGAGCCAGCACGGTGATGG - Intronic
1049805008 8:144534744-144534766 GGACTGAGGCAGCAATGAGAGGG + Intronic
1050725427 9:8643720-8643742 GTGCTGAGGCAGCAAGGGGCTGG - Intronic
1056098577 9:83278763-83278785 GTCCTGAGGGAGCAGAGTGCTGG + Intronic
1057149411 9:92783146-92783168 GCCCTGAGGTAGCATAGTGAAGG - Intergenic
1058620017 9:106872986-106873008 GTCATGAGGCTGCAAAGTGGGGG + Intronic
1060352832 9:122874018-122874040 GTGCTATGGCAGCATGGTGAAGG + Intronic
1061493996 9:130961351-130961373 GTCCTGAGGCAGAAGGGGGCCGG + Intergenic
1061759803 9:132842810-132842832 GTCATGTGGCAGCAAGGAAATGG - Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1186513709 X:10150277-10150299 GTGAGGAGGCAGCAAGCTGAGGG - Intergenic
1187697182 X:21934297-21934319 GATCAGAGTCAGCAAGGTGAGGG + Intergenic
1189731225 X:44023002-44023024 GTCCTGAGGCTCCAAAGTGAAGG - Intergenic
1189731458 X:44025379-44025401 TTTCTGAGGCAGGAAGGAGAAGG + Intergenic
1190765628 X:53473460-53473482 GTGCTGGGGGAGCAGGGTGAAGG + Intergenic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic
1192563790 X:72145817-72145839 CTCCAGAGGTAGCAAGGTGAGGG - Intergenic
1194319798 X:92430757-92430779 GTTATGAGGCAGTAAGGTGATGG + Intronic
1195578517 X:106476419-106476441 GTCCTGAGGAAGCCAGGCTACGG - Intergenic
1196438516 X:115695934-115695956 GTCCTTAGGGAACAAGGTGCTGG + Intergenic
1196992077 X:121341073-121341095 CTTCTGAGGCAGCAAGATGAAGG - Intergenic
1198169927 X:134095582-134095604 GTCCTGAGGTAGGACAGTGAAGG - Intergenic
1199722286 X:150550611-150550633 GCCCTGAGACAGCCAGGTGTGGG + Intergenic
1200000344 X:153056746-153056768 GTCCTGGGGCAGCGCGGGGAGGG + Intronic
1200627921 Y:5543890-5543912 GTTATGAGGCAGTAAGGTGATGG + Intronic
1201295581 Y:12460533-12460555 GTCCTGGGGCAGAAAGCTGATGG - Intergenic