ID: 1121466819

View in Genome Browser
Species Human (GRCh38)
Location 14:94121049-94121071
Sequence CAAGATAGTCACACTCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121466819_1121466823 -8 Left 1121466819 14:94121049-94121071 CCTCCTAGAGTGTGACTATCTTG No data
Right 1121466823 14:94121064-94121086 CTATCTTGGTAGGAATAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121466819 Original CRISPR CAAGATAGTCACACTCTAGG AGG (reversed) Intergenic
No off target data available for this crispr