ID: 1121467855

View in Genome Browser
Species Human (GRCh38)
Location 14:94127598-94127620
Sequence GAGATGGGCCGTGTGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121467855_1121467863 27 Left 1121467855 14:94127598-94127620 CCCTGGGTCACACGGCCCATCTC 0: 1
1: 0
2: 3
3: 15
4: 149
Right 1121467863 14:94127648-94127670 CTGCCTACCGATTATCTGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121467855 Original CRISPR GAGATGGGCCGTGTGACCCA GGG (reversed) Intergenic
900103274 1:971800-971822 AAGTTGGGCCGGGTGAACCATGG - Intronic
900158537 1:1212912-1212934 CAGATGGGCCGTGGGCCGCAGGG - Intronic
900595975 1:3480386-3480408 CAGAGGGGCCGGGGGACCCACGG + Intronic
901852062 1:12022067-12022089 GAGAGGGGCCGGGTCACCCAGGG - Intronic
903331073 1:22597556-22597578 CAGAGGGAGCGTGTGACCCAGGG + Intronic
903648016 1:24906278-24906300 CAGATGGGCTGTGTGACCCGAGG + Intronic
905702270 1:40026467-40026489 GGGATGGGCTATGTGACCAAGGG - Intergenic
906322853 1:44827539-44827561 GAGGTGGCCCTGGTGACCCAGGG - Exonic
906522046 1:46473156-46473178 GACATTAGCCGTGTGACCCCAGG + Intergenic
907285144 1:53375428-53375450 GAGATGGGGTGTGTGACGCTGGG + Intergenic
912369361 1:109161766-109161788 GAAATGGGCCCTGGGACCCCGGG - Intronic
920120871 1:203657052-203657074 GAATTGGGCCTTGTGACACAAGG - Intronic
920945625 1:210525848-210525870 AAGATGGGCTGTGAGATCCATGG + Intronic
922794969 1:228335373-228335395 GTGATGGGCAGTGTGCCCCAAGG - Intronic
1063917418 10:10897591-10897613 GAGATGAGGCCTGTGACTCATGG + Intergenic
1064394803 10:14973337-14973359 GATATGGGTCTTGTGGCCCAAGG + Intronic
1069630741 10:69895618-69895640 GAGCTGGGCGCTGTGCCCCAGGG - Intronic
1073584666 10:104698263-104698285 CACATGGGCCCTGAGACCCAAGG + Intronic
1074215048 10:111376015-111376037 GTGATGAGCTATGTGACCCAGGG + Intergenic
1075340593 10:121644411-121644433 GATCTGGGCCAGGTGACCCAGGG + Intergenic
1076473167 10:130734383-130734405 GTGATGGGCAGTGGTACCCATGG + Intergenic
1076739936 10:132478098-132478120 GAGAGGGGCCCTGGGGCCCAGGG + Intergenic
1076915985 10:133423393-133423415 GAGAAGGGCCGCGGGACCCGGGG - Exonic
1076936121 10:133568259-133568281 GAGAAGGGCCGCGGGACCCGGGG - Intronic
1077389865 11:2295502-2295524 AACATGGGCCATATGACCCACGG - Intergenic
1080628671 11:34052762-34052784 GAGACGGGGCGTGTGGGCCAGGG - Intronic
1081372311 11:42318942-42318964 GAGAAAGGCAGTGTGTCCCAGGG + Intergenic
1085799551 11:79576674-79576696 GAGGTGGGCCCTGTAGCCCAAGG + Intergenic
1085987497 11:81804826-81804848 CAGATGGGGCCTGTGACCCAGGG + Intergenic
1087142954 11:94783988-94784010 GCTATGAGCCCTGTGACCCAGGG + Intronic
1089884189 11:121803514-121803536 GAGATGGGCCTGCAGACCCAAGG - Intergenic
1090831666 11:130424878-130424900 GGGATGGGACATGAGACCCAGGG + Intronic
1091329095 11:134716621-134716643 GAGATGGGAGGTGAGACACAGGG - Intergenic
1091590790 12:1842011-1842033 AAAATGGGCTGTGGGACCCAGGG - Intronic
1091850842 12:3695546-3695568 GAAAGGAGCTGTGTGACCCAAGG - Intronic
1097084132 12:56454822-56454844 GAGATGAGCCGAGAGAGCCATGG + Intronic
1101843456 12:108343561-108343583 AAGATGGGCTGTGTGACCTTGGG + Intergenic
1101933330 12:109033848-109033870 GGGATGAGCTATGTGACCCAGGG - Intronic
1104882431 12:132081774-132081796 GAGTTGGGCATTGTGATCCAGGG + Intergenic
1105239342 13:18596291-18596313 CTGATGGGCTGTGTGTCCCATGG - Intergenic
1105836297 13:24215120-24215142 GAGATGGGGTGTGTGCTCCAGGG + Intronic
1106470403 13:30049313-30049335 GTGAAGGGCTGTGTGAACCATGG + Intergenic
1111250055 13:85590426-85590448 GAAGTGGGCCATGTGACCCTTGG - Intergenic
1113175378 13:107557733-107557755 GAGATGGGATTTGGGACCCATGG - Intronic
1115463215 14:33684954-33684976 AAGATGGGCAGTGTTTCCCATGG - Intronic
1118664740 14:68055866-68055888 GAGTTGGTCAGTGTGACCAATGG - Intronic
1121423735 14:93833557-93833579 GAGCTGGGGCTTGTGACTCAGGG + Intergenic
1121467855 14:94127598-94127620 GAGATGGGCCGTGTGACCCAGGG - Intergenic
1123491899 15:20787795-20787817 CTGATGGGCTGTGTGTCCCATGG + Intergenic
1123548405 15:21356886-21356908 CTGATGGGCTGTGTGTCCCATGG + Intergenic
1124219680 15:27838753-27838775 GAGAAGGTACGTGTGAACCAAGG + Intronic
1128521807 15:68380307-68380329 CAGATGGGCTAAGTGACCCACGG + Intronic
1129060864 15:72859356-72859378 GAGAAGGGCCCTGTGAGCCGTGG - Intergenic
1129960742 15:79681899-79681921 GGGATGGGACATGTGCCCCATGG + Intergenic
1131176032 15:90210372-90210394 GAGCATGGACGTGTGACCCAGGG + Intronic
1202956737 15_KI270727v1_random:84116-84138 CCGATGGGCTGTGTGTCCCATGG + Intergenic
1133805913 16:9125897-9125919 GAGATGGGCCTTCTGAGCCTGGG + Intergenic
1135625718 16:23993119-23993141 GAGATGCACTGTGTGACCCACGG + Intronic
1136028977 16:27489118-27489140 GAGATGGGCTGGGTGCCGCAGGG - Exonic
1136297203 16:29310328-29310350 CAGAGGGGACGTGTGAGCCAAGG - Intergenic
1142058754 16:88016430-88016452 CAGAGGGGACGTGTGAGCCAAGG - Intronic
1142373860 16:89697001-89697023 GAGAAGGACCCTGTGCCCCAAGG - Exonic
1142851091 17:2705072-2705094 AGGATTGGCCGTGTGAGCCACGG - Intronic
1144828601 17:18120034-18120056 GGGATGGGCGGTGGTACCCAGGG - Exonic
1147897311 17:43758997-43759019 GAGAGGGGGCGTGTGAGGCAAGG + Intergenic
1148216661 17:45837129-45837151 GAGATGGGGTGGGGGACCCAGGG + Intergenic
1150289309 17:63972480-63972502 GAGAGAGGCTGTGAGACCCAGGG + Intronic
1152572437 17:81126727-81126749 GAGGGGGGCCGTGTCCCCCAGGG + Intronic
1152619384 17:81354393-81354415 CACAAGGGCCGTGTGCCCCAGGG + Intergenic
1154449450 18:14462346-14462368 CTGATGGGCTGTGTGTCCCATGG + Intergenic
1156956921 18:42978033-42978055 GAAAAGGGCTCTGTGACCCAAGG + Intronic
1157835336 18:50896829-50896851 GAGGTGCTCTGTGTGACCCATGG - Intronic
1159713845 18:71797385-71797407 GTCATGGGCAGTGAGACCCAAGG - Intergenic
1161104048 19:2434551-2434573 CACCTGGGCCTTGTGACCCATGG - Intronic
1161605132 19:5210668-5210690 GAGATGGGCCGGGTGAGCTAGGG - Exonic
1162061252 19:8096829-8096851 GAGCTGGGCTCTGTCACCCATGG - Intronic
1163832560 19:19554119-19554141 GGGCTGGGCCGTGTGGCCCTAGG - Intergenic
1167169188 19:47819922-47819944 GGGAGGGGCCGTCTGACCCTCGG - Intronic
1167942050 19:52955761-52955783 GAGATGGGGTGTGGGCCCCATGG - Intronic
1168189638 19:54728308-54728330 GAGTTGGGCCATGTGGCCCCAGG + Intronic
925362505 2:3289335-3289357 AGGATGGGGCGTGTGACCCAGGG + Intronic
932711121 2:74063864-74063886 GAGATGGGCTTTGTTGCCCAGGG - Intronic
932812003 2:74833888-74833910 GAGATGGGACGTGTGGTCCGTGG - Intergenic
934524590 2:95043768-95043790 CAGATGGCCCCTGTGACCCTGGG + Intronic
936063624 2:109314059-109314081 GAGAGGGGCCGTGAGACCCGGGG + Intronic
938316758 2:130334932-130334954 GAGATTGGACATGTGACTCATGG + Intergenic
938481991 2:131670399-131670421 CTGATGGGCTGTGTGTCCCATGG - Intergenic
940111791 2:150162799-150162821 GACATGTACCGGGTGACCCAGGG + Intergenic
940157997 2:150679611-150679633 GAGATTAGGCGTGTGACTCATGG + Intergenic
940323273 2:152399500-152399522 GAGATGGGGTGTTGGACCCATGG + Intronic
941840442 2:170077309-170077331 GAGTTGGGCCTTGTGACACAAGG - Intronic
943513948 2:188862117-188862139 TAGGTGGGTGGTGTGACCCATGG + Intergenic
946196691 2:218036347-218036369 GAGTTGGGCAGTGAGACTCAGGG + Intronic
1169093307 20:2874185-2874207 GAGACGGGCCGGGGGACCGAGGG - Intronic
1169122693 20:3106928-3106950 GAGATGGGCCTTCTGACGCTCGG - Intergenic
1175065786 20:56286684-56286706 GCGATGAGCCCTGTGACCCAGGG + Intergenic
1175382921 20:58576202-58576224 CAGATGGCTTGTGTGACCCATGG + Intergenic
1177901367 21:26920241-26920263 GAGATTGGCTGTGTGTCCAAGGG + Exonic
1178809055 21:35864431-35864453 AACCTGGGCCGTTTGACCCACGG - Intronic
1180800987 22:18631842-18631864 GAGACGGGCTGTGTGACCCAGGG - Intergenic
1180852219 22:19027399-19027421 GAGACGGGCTGTGTGACCCAGGG - Intergenic
1181220731 22:21363420-21363442 GAGACGGGCTGTGTGACCCAGGG + Intergenic
1182782560 22:32879994-32880016 GAGTTGGGCTATGTGACCCCTGG + Intronic
1183469414 22:37997684-37997706 GGGAGGGGCAGGGTGACCCAGGG - Intronic
1183706627 22:39478497-39478519 GACATGAGCCGTCTGAACCACGG + Intronic
1184277480 22:43418466-43418488 GAGATGCTCTGTGTGAGCCAAGG + Intronic
1184326933 22:43795483-43795505 GAGCAGGGCCGAGGGACCCATGG - Intronic
1184582300 22:45425902-45425924 AAGATGGTCCGAGTGACCCCAGG - Intronic
1185162753 22:49239491-49239513 GAAATGGGACCTGGGACCCACGG - Intergenic
949538991 3:5017787-5017809 GAGCTGGGCTGTGTGACCTAGGG - Intergenic
952837929 3:37620234-37620256 GAGATGGCTCCTGTCACCCAAGG + Intronic
952958519 3:38575588-38575610 GAGCAGGGCCGTGTGAGCGAGGG + Intronic
953980875 3:47412446-47412468 GGGATGGGCCTTCTGTCCCAGGG + Intronic
954053113 3:47999042-47999064 GAAATGGACAGTCTGACCCAAGG + Intronic
960965275 3:123100178-123100200 GAGTTGAGCCCTGTGTCCCAGGG + Intronic
964739441 3:159950201-159950223 GAGATGGGCCATTTCAGCCAAGG + Intergenic
964787374 3:160412959-160412981 GAGATGGGCTGTTTCACCCAGGG + Intronic
968126278 3:196162848-196162870 GAGACTGGCCGGGTGACCCTGGG - Intergenic
968517074 4:1019848-1019870 GGGATGGGCCGGGTGAGCCAGGG + Intronic
968636851 4:1685098-1685120 GAGATGAGCCGCCTGACCCAGGG + Intergenic
968702423 4:2063253-2063275 GTGATGGCCCGGGTGACCCTGGG + Intronic
971872237 4:32257484-32257506 AAGGTGGGCCATGTGACCCTAGG - Intergenic
971906378 4:32732099-32732121 TAGGTGGCCGGTGTGACCCATGG + Intergenic
972325385 4:38010648-38010670 AAGATGGGGCGTGGTACCCAGGG - Intronic
974934594 4:68397559-68397581 GCTGTGGGCAGTGTGACCCATGG + Intergenic
982185709 4:152796147-152796169 GAAGTGGGCCTTGTGACACAGGG - Intronic
986492324 5:8306163-8306185 TAGAAGGCTCGTGTGACCCATGG + Intergenic
987335576 5:16895480-16895502 TAGATGGGGCGTGTCATCCAGGG - Intronic
987751121 5:22039278-22039300 GAGCTGGGCCCTGGTACCCAGGG + Intronic
988844921 5:35118015-35118037 CAGATGGGTGGTGTGACCGAGGG + Intronic
992241467 5:74774021-74774043 GAATTGGGCCTTGTGACACAAGG + Exonic
997193287 5:131959951-131959973 GAAATGGACCATGTGACTCAAGG + Intronic
1000965710 5:167653703-167653725 GAGGTGGGTCATGTGACCTAGGG + Intronic
1001157127 5:169282337-169282359 GAGATGAACCGTCTGAGCCAAGG + Intronic
1001753336 5:174147860-174147882 GAGCTGGGCAGAGTGTCCCAAGG + Intronic
1005587199 6:27288368-27288390 GAGAGTGGCCGCCTGACCCAGGG - Intronic
1006585629 6:35109165-35109187 GAGATTGGCTCTTTGACCCACGG - Intergenic
1007830746 6:44636576-44636598 GAGATGGAGCTTGAGACCCAAGG + Intergenic
1008819015 6:55608902-55608924 TAGATGGTTAGTGTGACCCACGG + Intergenic
1016833488 6:148455089-148455111 AAGATGGGCCCTGTGATCCCTGG + Intronic
1018996175 6:168712081-168712103 GAGATGGGCCAAGTGGCCGAGGG + Intergenic
1019283052 7:210199-210221 GGGCTGGGCCGTGAGACCCGTGG - Intronic
1020444072 7:8249976-8249998 GAAATGGGACTTGTGATCCAGGG + Intronic
1029115855 7:98236717-98236739 GGGATGGGCCGTCTGAGCCTAGG - Intronic
1032749405 7:134823027-134823049 GGGGTGGGCAGGGTGACCCACGG - Intronic
1034535490 7:151723488-151723510 GGGGTGGGCCGCGTGACCTAGGG - Intronic
1035715920 8:1754855-1754877 GAGATGGCCTGTTTGACCCCAGG - Intergenic
1035741319 8:1930362-1930384 GAGCTGGGCGGTGTGGACCAGGG - Intronic
1036687758 8:10923250-10923272 AAAAGGGGCCGTGTGACCCTTGG - Intronic
1047424079 8:124729611-124729633 GAGTTGGGCAGAGTGATCCAGGG - Intergenic
1047727135 8:127693834-127693856 GAGATGGGCTGTCTCATCCATGG - Intergenic
1047957109 8:129984477-129984499 GAGATGGGATGAGTCACCCAAGG + Intronic
1048509407 8:135048802-135048824 GTGATGGGCAGTGTGCCCCAGGG - Intergenic
1049406654 8:142454594-142454616 GAGACTGGCAGTGGGACCCAGGG + Intronic
1049774821 8:144399403-144399425 GAGCGGGGCCAGGTGACCCAGGG - Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1056841273 9:89999730-89999752 GAGATGTGCCCTCTGCCCCAGGG + Intergenic
1057827492 9:98382167-98382189 GAGATGGGCAGAGTGGCCCCCGG + Intronic
1060186310 9:121566214-121566236 GAGATGGGACGGGGGAGCCAGGG - Intergenic
1060484255 9:124037167-124037189 GAGAGGGGTCCTGTCACCCAAGG - Intergenic
1061809812 9:133155728-133155750 GACCTGGGCTGTGTGACCCTGGG - Intronic
1061870267 9:133516685-133516707 CAGCTGGACCGTGTGACCCTGGG + Intronic
1188004959 X:25010858-25010880 GTAATGGGGAGTGTGACCCAAGG - Intronic
1191885246 X:65881417-65881439 GTGATGGGCTGTGTGACCTTGGG - Intergenic
1194068225 X:89288119-89288141 CAGATGGGCAGGGAGACCCATGG + Intergenic
1198057430 X:133008712-133008734 CAGATGGGCAGTGTTGCCCAGGG - Intergenic
1200722367 Y:6622289-6622311 CAGATGGGCAGGGAGACCCATGG + Intergenic
1200818112 Y:7554846-7554868 TAGAAGGCCTGTGTGACCCACGG + Intergenic