ID: 1121468886

View in Genome Browser
Species Human (GRCh38)
Location 14:94136641-94136663
Sequence AGTTTGGCTCAGAACCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121468886_1121468892 12 Left 1121468886 14:94136641-94136663 CCACTGGGGTTCTGAGCCAAACT No data
Right 1121468892 14:94136676-94136698 TACAGTGACTGGGTTTGCCTGGG No data
1121468886_1121468889 1 Left 1121468886 14:94136641-94136663 CCACTGGGGTTCTGAGCCAAACT No data
Right 1121468889 14:94136665-94136687 CCAGCTTAAAATACAGTGACTGG No data
1121468886_1121468890 2 Left 1121468886 14:94136641-94136663 CCACTGGGGTTCTGAGCCAAACT No data
Right 1121468890 14:94136666-94136688 CAGCTTAAAATACAGTGACTGGG No data
1121468886_1121468891 11 Left 1121468886 14:94136641-94136663 CCACTGGGGTTCTGAGCCAAACT No data
Right 1121468891 14:94136675-94136697 ATACAGTGACTGGGTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121468886 Original CRISPR AGTTTGGCTCAGAACCCCAG TGG (reversed) Intergenic
No off target data available for this crispr