ID: 1121472154

View in Genome Browser
Species Human (GRCh38)
Location 14:94164402-94164424
Sequence CGGTGTATGTGGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121472146_1121472154 22 Left 1121472146 14:94164357-94164379 CCAGCACTTTTAATGACAGATTA 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
1121472145_1121472154 28 Left 1121472145 14:94164351-94164373 CCAAAGCCAGCACTTTTAATGAC 0: 1
1: 0
2: 3
3: 12
4: 194
Right 1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
1121472144_1121472154 29 Left 1121472144 14:94164350-94164372 CCCAAAGCCAGCACTTTTAATGA 0: 1
1: 0
2: 4
3: 19
4: 244
Right 1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121472154 Original CRISPR CGGTGTATGTGGAAGGTGCA GGG Intronic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
901218892 1:7570976-7570998 TGGTGTATCTGTAAGGTGTAAGG + Intronic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902242880 1:15100438-15100460 TGGTCTAAGTGGGAGGTGCAGGG - Intronic
903384303 1:22916587-22916609 TGGTGTAAGTGGAAGGCGCTTGG - Intergenic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
910052660 1:82994027-82994049 TGGTATATGTGGAAGTTTCAGGG + Intergenic
911207493 1:95106615-95106637 CGTGGGATGTGGAAGTTGCAGGG + Intergenic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
912799738 1:112713536-112713558 TGGTGTATGTGGAAGGTCGGAGG - Exonic
916281768 1:163059909-163059931 CAGTGTATGTGGCAGAGGCATGG + Intergenic
918578752 1:186099317-186099339 CTGTGTGTCTGGGAGGTGCAGGG + Intronic
923082310 1:230669913-230669935 CAGTGTACGAGGAAGGTGCAGGG + Intronic
1067375685 10:45726341-45726363 GGGTGTGTGAGCAAGGTGCATGG + Intergenic
1067543572 10:47175660-47175682 CAGTGCATGTGGAAGGTGTTTGG - Intergenic
1067883396 10:50067030-50067052 GGGTGTGTGAGCAAGGTGCATGG + Intergenic
1070452073 10:76569459-76569481 ACATGTATGAGGAAGGTGCAGGG + Intergenic
1071121466 10:82283678-82283700 CTGTGTATCTGGAAGGAGCCTGG + Intronic
1071586818 10:86831200-86831222 TCGTGTATAAGGAAGGTGCAGGG - Intronic
1073383903 10:103106407-103106429 TGGTGTATATGGAAAGTTCATGG + Intronic
1073967468 10:109007819-109007841 AGGGAAATGTGGAAGGTGCAAGG + Intergenic
1074933294 10:118151608-118151630 TGGGGTTTGTGGAATGTGCAGGG - Intergenic
1076673999 10:132138284-132138306 CGGTGTACGTGGAGGGCGCTGGG + Intronic
1076674028 10:132138420-132138442 CGGTGTATGTGGAGGGCGCTGGG + Intronic
1076856925 10:133121346-133121368 CTGTGTGTGTGGAATGTGCCAGG + Intronic
1077466027 11:2734154-2734176 AGGTGTGTGTGAGAGGTGCATGG + Intronic
1080729779 11:34937464-34937486 CGGGGTGGGTGGAAGGAGCAAGG + Intronic
1081456043 11:43223908-43223930 GTGTGGATGTGGAAGCTGCAAGG - Intergenic
1085535629 11:77215565-77215587 AGGTGTTTCTGGCAGGTGCAAGG - Intergenic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1086018679 11:82199107-82199129 GTTTGTATGTGGAAGGTGCTGGG + Intergenic
1091265414 11:134267155-134267177 CGCTGGATGTGGAAGGTGGAAGG + Intergenic
1092252511 12:6907940-6907962 TGGTGTATGTGGGCGGTGTAGGG - Intronic
1094414444 12:30202063-30202085 TGGTGTGTGTGGAAGGGGCGGGG + Intergenic
1095257711 12:40059589-40059611 CAATGTATGGGGAAGGAGCACGG + Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1101550400 12:105756178-105756200 CAGTCTATGTGGAAGCTGTAGGG + Intergenic
1108756037 13:53503408-53503430 CGGGGTAGGTGGAAGGAGAAAGG - Intergenic
1113139546 13:107131854-107131876 CTGTGCATTTGGAAGGTGCAGGG - Intergenic
1113939743 13:114012386-114012408 TGGAGTGTGTGGACGGTGCACGG - Intronic
1113939757 13:114012451-114012473 GAGTGTGTGTGGACGGTGCATGG - Intronic
1114647802 14:24265191-24265213 GGGAACATGTGGAAGGTGCAGGG + Intergenic
1118071184 14:62248313-62248335 CTGAATCTGTGGAAGGTGCAGGG - Intergenic
1118758712 14:68864472-68864494 TGGTTTACGTGGGAGGTGCAGGG + Intergenic
1121010323 14:90516562-90516584 GGTTTTATCTGGAAGGTGCAGGG + Intergenic
1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG + Intronic
1123469159 15:20537373-20537395 CAGTGAATGTGGAAGGGACAGGG + Intronic
1123648901 15:22463325-22463347 CAGTGGATGTGGAAGGGACAGGG - Intronic
1123729435 15:23132360-23132382 CAGTGGATGTGGAAGGGACAGGG + Intronic
1123747603 15:23329842-23329864 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124279965 15:28353693-28353715 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124302734 15:28557918-28557940 CAGTGGATGTGGAAGGGACAGGG - Intergenic
1125475765 15:40047257-40047279 AGGGGTGTGTGGAAAGTGCATGG - Intergenic
1125951048 15:43751702-43751724 AGGTGTGTGTGTAAGCTGCAAGG - Intronic
1126332475 15:47548355-47548377 AGGTGTTTCTGGCAGGTGCAAGG - Intronic
1127634930 15:60859958-60859980 AGGTGTAGGTGGTAGGTGCATGG - Intronic
1129352273 15:74963031-74963053 TGGTGTCTGTGGAAGGGGAAAGG + Intronic
1129881870 15:79012176-79012198 CGGTGTTTGGGGAGAGTGCAGGG - Intronic
1130045999 15:80445359-80445381 TGGTGTATGTGGAGTGTGTAGGG + Intronic
1130656642 15:85795878-85795900 AGGTGGAGGTGGGAGGTGCAAGG + Intergenic
1131857273 15:96610381-96610403 CAGTGGCTGTGGCAGGTGCAAGG - Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1134819269 16:17233051-17233073 CTTTGTATGTGGCAGGTGAAGGG - Intronic
1134867218 16:17619315-17619337 CGTGGTATGTGGAAGCTTCAGGG - Intergenic
1136076465 16:27820592-27820614 CGGTGAATGTGTAAGGAGCCAGG + Intronic
1138069082 16:53972806-53972828 CAGTGTTTGTGGAGAGTGCAGGG + Intronic
1138586563 16:57974163-57974185 AGGTGTATGTGGAAGCTTCTAGG + Intergenic
1143970740 17:10793487-10793509 CAGTGCATGTGGAAATTGCAGGG - Intergenic
1144744954 17:17607954-17607976 TGGTGGAGGTGGGAGGTGCAGGG - Intergenic
1145119840 17:20248231-20248253 CAGAGGATCTGGAAGGTGCAAGG - Intronic
1145172325 17:20669232-20669254 CAGAGGATGTGGAAGGTACAGGG - Intergenic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1148051878 17:44773543-44773565 GGGGGTAGGTGGCAGGTGCAAGG - Intronic
1148202422 17:45758115-45758137 CCGTGGAAGTGGAATGTGCAGGG + Intergenic
1148342822 17:46883726-46883748 CGGGGTATGAGGGAGTTGCAAGG + Intronic
1152405806 17:80097141-80097163 TGGAGTGTGTGGAAGGTGCCTGG + Intronic
1155341355 18:24817600-24817622 GGGTGTTTGTGGCTGGTGCATGG + Intergenic
1158330085 18:56352368-56352390 AGGTGTATGTGGAAAGTGAAAGG - Intergenic
1158824049 18:61194425-61194447 GGGAGTATGTGGGAAGTGCATGG + Intergenic
1160005638 18:75067249-75067271 CAGTGGATGTGGAAGAAGCAGGG + Intergenic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1163761261 19:19137964-19137986 CGGGGTGTGTGGAACGGGCAGGG - Intronic
1167872623 19:52385707-52385729 CGATGCATGTCGAAGGTCCAAGG + Exonic
926211536 2:10874421-10874443 CAGGGTTTGTAGAAGGTGCAAGG - Intergenic
927175164 2:20400612-20400634 TGGTGTATCTGGAAAGGGCAGGG + Intergenic
927430803 2:23024835-23024857 AGGTGTGTGTGGAAGGTGCGAGG - Intergenic
927470864 2:23375487-23375509 AAGTGTATGGAGAAGGTGCAGGG + Intergenic
928001242 2:27524587-27524609 AGGTGTTTGTGGAAGATGAAAGG - Intergenic
929559003 2:42944007-42944029 GGGAGGATGTGGATGGTGCAAGG - Intergenic
931218894 2:60271304-60271326 CTGGGTATGTGGATGGTGAATGG - Intergenic
931391919 2:61851778-61851800 GGGTGTATAGGGATGGTGCAGGG + Intronic
931841370 2:66153170-66153192 CTGTGTATGTGGATGGTGTTGGG + Intergenic
934551743 2:95267093-95267115 CGGTGGACGTGGAAGGTGGGGGG + Intergenic
936122159 2:109756433-109756455 TGGCGTATGTGGAAGCTGCCTGG + Intergenic
936222535 2:110615041-110615063 TGGCGTATGTGGAAGCTGCCTGG - Intergenic
937821241 2:126313443-126313465 GTGTGTATGTGGTGGGTGCAGGG - Intergenic
941129540 2:161629476-161629498 CTATGTATGTGTAAGGGGCAGGG - Intronic
941196819 2:162462720-162462742 CTGTGTATTTGCAAGGTGTATGG + Intronic
942369251 2:175264454-175264476 CGGTGTATGTGGATCATGGAGGG + Intergenic
942608400 2:177715898-177715920 CAGTGTATGTGGGTGGTGCCTGG + Intronic
947078558 2:226370202-226370224 TGGTGTGTGTTGAAGGGGCAGGG - Intergenic
948822806 2:240558367-240558389 CAGTAAATGTGGAAGGCGCAAGG + Intronic
1168748073 20:261829-261851 CAGGGGATGTGAAAGGTGCATGG + Intergenic
1169354735 20:4897119-4897141 TGGTCTATGTGGCAGGTGCGGGG - Intronic
1171021343 20:21586926-21586948 CAGTGTTTATGGCAGGTGCAGGG - Intergenic
1173057322 20:39627978-39628000 CGTTGTATGTGAGAGGTGGAGGG + Intergenic
1173591610 20:44229172-44229194 AGGTGTATGTGGAGGTTGCGTGG + Intergenic
1174039343 20:47688029-47688051 GGGTGCATGGGGAGGGTGCAGGG + Intronic
1174740034 20:53003977-53003999 CAGTGTCTGTGGAAAGTTCAGGG + Intronic
1179833937 21:44016038-44016060 GAGTGTATGTGAAATGTGCAGGG + Intronic
1179904710 21:44416472-44416494 GGGTGCATGTGGAAGGGGCAGGG - Intronic
1180942556 22:19668881-19668903 CAGTCTTTGTGGAAGGTGAACGG + Intergenic
1182218646 22:28740781-28740803 TGGTGTATGTGAACAGTGCAAGG - Intronic
1182875001 22:33684172-33684194 CGGTGAATGTGGAATGTGTTTGG + Intronic
1182889703 22:33807042-33807064 CTGTCTTTGTGGAAGTTGCATGG - Intronic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
951057553 3:18164949-18164971 TGGTTTATTTGGGAGGTGCAGGG - Intronic
952123103 3:30267878-30267900 TGCTGAATGTGGAAAGTGCATGG + Intergenic
952711150 3:36433175-36433197 CGGTGTATCTGGAACATGCCTGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
961388761 3:126539526-126539548 CGGTGTGTGTGGTGTGTGCATGG - Intronic
964544225 3:157815863-157815885 CAGTGTAGGTGGCTGGTGCATGG - Intergenic
965079375 3:164018571-164018593 AGGTGGATATGGAAGTTGCAAGG + Intergenic
966474595 3:180329285-180329307 CGGCTTATTTGGAAGGTGAAAGG + Intergenic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
970813642 4:20126978-20127000 TGGTGTATGTGAAAGTTGCCTGG - Intergenic
970982811 4:22122184-22122206 TGGTGTATGTGTGTGGTGCATGG - Intergenic
971367412 4:25988444-25988466 GGGTGAATGTGGAAGGTGATTGG + Intergenic
979412380 4:120395100-120395122 GGGTGCATGCGGACGGTGCAAGG - Intergenic
981277651 4:142920635-142920657 AGGTGTATGGAGAAGGTACAGGG - Intergenic
983721735 4:170862284-170862306 CGATGTATTTGGAATGTGCATGG - Intergenic
988498291 5:31763137-31763159 CTGTGTTTTTGGAAGCTGCAGGG + Intronic
990440494 5:55839976-55839998 GGGTTTATGTTGAAGGTCCACGG - Intergenic
998104452 5:139459549-139459571 CTGTGTATGTGGAACCTGAAAGG + Intronic
999068326 5:148715935-148715957 AGGTGTGTGTGGTAGGGGCACGG + Intergenic
1002871579 6:1171153-1171175 AGGAGTATGTGGAAGGTCCCAGG - Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1003901600 6:10660033-10660055 CAGTAGATGTGGAGGGTGCACGG + Intergenic
1004066127 6:12246184-12246206 CGATTTAAATGGAAGGTGCAGGG + Intergenic
1004619362 6:17319811-17319833 AGGTGGATATGGAAGTTGCAAGG + Intergenic
1010024417 6:71199124-71199146 GTGTGAATGTGGAAGGGGCAGGG + Intergenic
1013158182 6:107514259-107514281 AGTTGCATATGGAAGGTGCATGG + Intronic
1013235600 6:108195412-108195434 CGCTGCATGTGGAAGGAGCATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1023272579 7:38480598-38480620 AGTTGTAAGTGGTAGGTGCAGGG - Intronic
1023843499 7:44109092-44109114 GGGTTTCTCTGGAAGGTGCAAGG - Exonic
1024935948 7:54712492-54712514 AGGTGTATGTCAAAGGTCCAGGG - Intergenic
1024963386 7:55001856-55001878 AGGTGTCTGTGGAAGGAGGATGG - Intergenic
1026564884 7:71481580-71481602 TGGGAGATGTGGAAGGTGCAGGG + Intronic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1034924384 7:155109649-155109671 CTGTGTGTGAGGAATGTGCAGGG + Intergenic
1035778846 8:2211267-2211289 AGTTGTCTGTGGAAGGTGAACGG - Intergenic
1036709104 8:11066984-11067006 AGGTGCATGTGGAAGCTTCATGG + Intronic
1038307324 8:26416675-26416697 TGGTGTCTGTGAATGGTGCAAGG + Intronic
1045341699 8:101260723-101260745 CACTGTATGTGCCAGGTGCAGGG - Intergenic
1045662551 8:104453047-104453069 CGGTGTATCTGGAAGCTGTTGGG - Intronic
1047957920 8:129989516-129989538 GGGTGTAGGTAGCAGGTGCATGG + Intronic
1051943933 9:22542896-22542918 CATTGCATGGGGAAGGTGCAAGG - Intergenic
1055349340 9:75370110-75370132 GTGTGTATGTAGAGGGTGCAGGG - Intergenic
1203746968 Un_GL000218v1:45267-45289 AGGTGAAGGTGGAAGGAGCAGGG - Intergenic
1185742674 X:2546395-2546417 GGGTGGGTGTGGAAGGTGCGGGG + Intergenic
1188668975 X:32859752-32859774 TGGTGTATGTTGAAGATGAAAGG - Intronic
1188873548 X:35402537-35402559 GGGTTTATGTGGAAGTTGGAAGG - Intergenic
1188981361 X:36730043-36730065 GTGTATATGTGGAGGGTGCAGGG - Intergenic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196599534 X:117585688-117585710 GGGAGTATGTGGGAGGGGCATGG - Intergenic