ID: 1121478681

View in Genome Browser
Species Human (GRCh38)
Location 14:94239756-94239778
Sequence CTGTCTTAATAGCTGGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121478681_1121478684 21 Left 1121478681 14:94239756-94239778 CCTTATACCAGCTATTAAGACAG 0: 1
1: 0
2: 0
3: 1
4: 94
Right 1121478684 14:94239800-94239822 TTTGTGTTTGGCTTTTTTGCTGG 0: 1
1: 0
2: 1
3: 85
4: 897
1121478681_1121478683 9 Left 1121478681 14:94239756-94239778 CCTTATACCAGCTATTAAGACAG 0: 1
1: 0
2: 0
3: 1
4: 94
Right 1121478683 14:94239788-94239810 TGTCTTATATTTTTTGTGTTTGG 0: 1
1: 1
2: 2
3: 75
4: 943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121478681 Original CRISPR CTGTCTTAATAGCTGGTATA AGG (reversed) Intronic
915709260 1:157878594-157878616 CTGTCTTAGGTGCTAGTATAGGG + Intronic
916501814 1:165393840-165393862 TTGTCTTCAGAGCTGGTTTAAGG - Intergenic
916558885 1:165915802-165915824 CTCACTTAATAGCTGGTCTTGGG + Intergenic
920075565 1:203334002-203334024 CTGTCTTGGCGGCTGGTATATGG + Intergenic
1063247708 10:4239532-4239554 CTATTTTTATATCTGGTATATGG - Intergenic
1063734787 10:8740563-8740585 CTATCTTAATTTCTGGCATATGG + Intergenic
1068732246 10:60372485-60372507 CTATATAAATAGCTGGCATATGG + Intronic
1069089840 10:64186731-64186753 CTGTCTTAATAGAGAGTTTAGGG + Intergenic
1072390521 10:94980982-94981004 TTTTCTTAATATCTGGTTTATGG + Intronic
1078747652 11:14130475-14130497 ATGTCAGAATAACTGGTATAAGG - Intronic
1078747676 11:14130941-14130963 GTGTCAGAATAACTGGTATAAGG + Intronic
1078750894 11:14162729-14162751 ATGTCAGAATAACTGGTATAAGG + Intronic
1079730039 11:23928980-23929002 CTATCTTAATCCCTGGTATCTGG - Intergenic
1089185915 11:116614597-116614619 CTGTCTGAACAGCTGTCATAGGG + Intergenic
1089514495 11:119023676-119023698 CTGTCTTAATCGATGGTTTTGGG + Exonic
1098536177 12:71595743-71595765 CTGTCATAATAGTTATTATAAGG + Intergenic
1102161002 12:110768868-110768890 CTCTGTTAATAGGTGGTACAAGG - Intergenic
1103854046 12:123952507-123952529 CTTTCTTAAAAGCAGGTATTTGG - Intronic
1104312268 12:127664004-127664026 CTGGCTTAATATGTGGCATAAGG + Intergenic
1104346047 12:127999865-127999887 CTGTGTTAACAGCAGTTATAAGG - Intergenic
1108475176 13:50809192-50809214 CTTTCTAAATATCTGGTACAAGG - Intronic
1116321859 14:43478366-43478388 CTGTCTTCCTAGCTTGTAGATGG + Intergenic
1121478681 14:94239756-94239778 CTGTCTTAATAGCTGGTATAAGG - Intronic
1129107157 15:73318332-73318354 CTGTCTGAATTGCTGGTACATGG + Intergenic
1133212196 16:4269873-4269895 GAGTCTTAAAAGCAGGTATATGG - Intronic
1138112591 16:54336807-54336829 CGGTCTTAATAGCTGCTAATTGG - Intergenic
1138580502 16:57937865-57937887 CTGACTTAATGGCTGGGATGAGG + Intronic
1140422195 16:74829308-74829330 CTCTCTTAATATTTGTTATAGGG - Intergenic
1141439156 16:84018160-84018182 CTGTCTTCAGAGGTGGCATAGGG + Intronic
1145944629 17:28764024-28764046 CTGTTTGAATAGCTGATAAAAGG - Intronic
1147815596 17:43207714-43207736 CTATCTGAATAGTTGTTATACGG + Intronic
1153613914 18:6916580-6916602 CTGTCTTTATAGCTAATACATGG - Intergenic
1155399376 18:25420982-25421004 CTGTCTTAATAGTGGGAATCTGG - Intergenic
1155689109 18:28595112-28595134 CTGTATTGATTGATGGTATATGG + Intergenic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1163871955 19:19829346-19829368 CTATCAAAATATCTGGTATATGG + Intergenic
1164019209 19:21282761-21282783 CTGGCTTAATAGTTGGAATTGGG - Intronic
929984665 2:46716226-46716248 CTTTTCTAATAGCTGTTATAAGG + Intronic
930500569 2:52211714-52211736 CCATCATAATAACTGGTATATGG - Intergenic
930566246 2:53024053-53024075 CTGTCCTAATAACTGGAATCGGG + Intergenic
934762142 2:96862357-96862379 GAGTCATAATAGCTGGTAAAAGG + Intronic
939807924 2:146796307-146796329 CTGTCTTAATGTCCAGTATAAGG - Intergenic
943640306 2:190350514-190350536 CTGTTCTGATAGCTTGTATATGG - Intronic
945828104 2:214749408-214749430 CTGTCTTAATGGTTGGTACTTGG - Intronic
946134186 2:217632098-217632120 CTGACTTATTAGCTGGAATTTGG - Intronic
946855505 2:223945744-223945766 CTGAGTTAATGCCTGGTATATGG - Intergenic
947371549 2:229451651-229451673 AAGTCTAAATAGCTAGTATATGG + Intronic
1175988278 20:62775156-62775178 ATGTCTTAAGAGCTGGCATGAGG + Intergenic
952016646 3:28964615-28964637 CTGTCTTCATAGCTGATAGTTGG + Intergenic
952678012 3:36056197-36056219 CTGCCTTAATTTCTAGTATAGGG + Intergenic
954010183 3:47629639-47629661 CTTTCTAAGAAGCTGGTATAAGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957004269 3:74926027-74926049 AAGTCTTAATAGCTGGTAAGAGG - Intergenic
963562292 3:146881039-146881061 CTGTTTCAATAGGTTGTATAAGG + Intergenic
964142654 3:153421511-153421533 ATGTCTTAACAGATGATATATGG - Intergenic
964663149 3:159143089-159143111 CTTTCTTAAGAGCTGATGTACGG - Intronic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
965777355 3:172245466-172245488 TTTTCTTAATAGCTAGTAGAGGG + Intronic
970924103 4:21430455-21430477 CTATGTTGATAGCGGGTATATGG - Intronic
973298265 4:48551267-48551289 ATGTATAAATAGGTGGTATATGG - Intronic
980888669 4:138790500-138790522 CTGTCTGAATTGCTGGAAAATGG + Intergenic
982466227 4:155736186-155736208 CTGTCCTAATATGTAGTATATGG - Intergenic
988570779 5:32363382-32363404 CCATCTTAACACCTGGTATATGG - Intronic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
994601939 5:101916960-101916982 CTTTCTTTATAACTGGAATAAGG + Intergenic
994711568 5:103271251-103271273 CTGTTTTCAAAGCTGGTCTAAGG + Intronic
995328896 5:110924077-110924099 ATGGCTTATTAGCTGGTATTTGG + Intergenic
1000145603 5:158450265-158450287 TTGTTTGAATAGCTGGAATAAGG + Intergenic
1000297852 5:159927729-159927751 CTGTTTTAAAACCTGGAATAAGG + Intronic
1000304812 5:159985460-159985482 ATGTCTTAATATCTGGTCTCTGG + Intergenic
1000573601 5:162947024-162947046 ATTTCTTAATGACTGGTATATGG + Intergenic
1000998928 5:167986804-167986826 CTGTCTTAACAGCCGGTTCAGGG + Intronic
1010824986 6:80462319-80462341 CTTTCTCAATAGTTGGTACATGG + Intergenic
1011500037 6:87978176-87978198 ATGTGTTACTAGCTGGAATAGGG - Intergenic
1012235974 6:96815950-96815972 CTGTCTTGGTATCTGGTATGTGG - Intronic
1014792959 6:125695373-125695395 CTGCCTTTTTAGCAGGTATAAGG + Intergenic
1014986138 6:128012758-128012780 CTATCTTAATAGCTGTGATTAGG + Intronic
1015007791 6:128304788-128304810 CTGTCTTCCTAGCTGGACTAGGG - Intronic
1024572214 7:50732686-50732708 GGGTGTTAATAGATGGTATAGGG - Intronic
1031424768 7:121592167-121592189 CTCTCTTCATTGCTGGTAGATGG + Intergenic
1037431011 8:18813193-18813215 CTGACTTAAAAGCTGGTGGAAGG + Intronic
1037597662 8:20367881-20367903 CTGTCCTAATCGCTTATATAGGG - Intergenic
1038068601 8:23988954-23988976 CTGTTTTAATATATAGTATATGG + Intergenic
1042783834 8:72523864-72523886 TTGTCTTAATTGGAGGTATATGG - Intergenic
1045187594 8:99854834-99854856 CTGTCTATATAGCTGGCAAAGGG + Intronic
1047894279 8:129348673-129348695 TTGTTTTAATAGCTGATGTATGG - Intergenic
1048252319 8:132876977-132876999 GTGTCTTAATATATGGTAAAGGG + Intronic
1050377725 9:4990376-4990398 CAGTGTTAGTAGCTGGTAGAGGG + Intronic
1058575456 9:106396213-106396235 CTAGCTTAATAGCTGGCACAGGG - Intergenic
1061031364 9:128085535-128085557 CTGTCTTAGGTGCTGGTCTAGGG + Intronic
1187896209 X:23981969-23981991 CTGACTTAATGTCTGGTACATGG - Intergenic
1189310854 X:40016233-40016255 CTGTCTTAATACCTGTGATCAGG - Intergenic
1190976319 X:55405151-55405173 TAGTTTTGATAGCTGGTATAAGG - Intergenic
1193954964 X:87848650-87848672 CTGTCTAAATAGATGTGATAAGG + Intergenic
1199111723 X:143943255-143943277 ATGATTTAATAGCTGGTACAAGG + Intergenic
1200947171 Y:8855179-8855201 CTGACTTAACAGCTGGCAGATGG + Intergenic