ID: 1121480149

View in Genome Browser
Species Human (GRCh38)
Location 14:94261271-94261293
Sequence TTGCATTTTGATATGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 630}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121480147_1121480149 -9 Left 1121480147 14:94261257-94261279 CCAGTCTAGGGCCTTTGCATTTT 0: 1
1: 0
2: 2
3: 26
4: 283
Right 1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG 0: 1
1: 0
2: 2
3: 36
4: 630
1121480144_1121480149 10 Left 1121480144 14:94261238-94261260 CCTCTTAAAATTGCTTTGGCCAG 0: 1
1: 0
2: 2
3: 33
4: 273
Right 1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG 0: 1
1: 0
2: 2
3: 36
4: 630
1121480143_1121480149 11 Left 1121480143 14:94261237-94261259 CCCTCTTAAAATTGCTTTGGCCA 0: 1
1: 0
2: 6
3: 73
4: 540
Right 1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG 0: 1
1: 0
2: 2
3: 36
4: 630
1121480141_1121480149 22 Left 1121480141 14:94261226-94261248 CCATCTTTGTTCCCTCTTAAAAT 0: 1
1: 0
2: 1
3: 50
4: 677
Right 1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG 0: 1
1: 0
2: 2
3: 36
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121480149 Original CRISPR TTGCATTTTGATATGAAGTC TGG Intronic
903970081 1:27113148-27113170 TTGCATTTTGATGTGAGCTTGGG - Intronic
904209184 1:28874797-28874819 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
904787118 1:32991541-32991563 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
905701558 1:40019984-40020006 TTATTTTTTGAGATGAAGTCTGG + Intergenic
906021056 1:42629984-42630006 TTTTTTTTTGAGATGAAGTCTGG + Intronic
907439427 1:54469905-54469927 TTTTATTTTGAGATGGAGTCTGG + Intergenic
908613723 1:65893234-65893256 TTGCATTTTAATATAAATTTAGG - Intronic
908991435 1:70095986-70096008 TTGTTTTTTGAGATGGAGTCTGG + Intronic
909330861 1:74408744-74408766 TTGCATTTGGATTTGAAGCAGGG - Intronic
909480142 1:76121702-76121724 TTGTTTTTTGAGATGGAGTCTGG - Intronic
909780810 1:79544206-79544228 TTGCTTTTTTACATGATGTCAGG - Intergenic
910054587 1:83017128-83017150 TTGCATTATAAGATGAAGCCTGG + Intergenic
910074073 1:83256795-83256817 TGGCATAAAGATATGAAGTCTGG - Intergenic
910832890 1:91478257-91478279 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
910868968 1:91814144-91814166 TTCCATGTTGATTAGAAGTCGGG + Intronic
911574132 1:99554400-99554422 TTGCAGTATAATTTGAAGTCAGG - Intergenic
911665837 1:100550304-100550326 TTGCAGTATAATTTGAAGTCAGG + Intergenic
912011211 1:104966061-104966083 TTACATTTGGGTCTGAAGTCTGG + Intergenic
912045210 1:105445099-105445121 TTGCAGTATAATTTGAAGTCAGG + Intergenic
912340375 1:108908706-108908728 TTGTGTTTTGAGATGGAGTCTGG - Intronic
913045007 1:115066733-115066755 TTGCATTATTATATGCATTCAGG - Intronic
913412464 1:118568171-118568193 TTGCATTTTCATATAAATTTTGG - Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
914791874 1:150885590-150885612 TTTTTTTTTGATATGGAGTCTGG + Intergenic
915851534 1:159329283-159329305 TTGTAGTATGATTTGAAGTCAGG - Intergenic
916767515 1:167875939-167875961 TTTCTTTTTGAGATGGAGTCTGG - Intronic
917228034 1:172804634-172804656 TTTCTTTTTGAGATGGAGTCTGG + Intergenic
917289021 1:173453179-173453201 TTGCCTTTTTATATAAAGTTAGG - Intergenic
917591767 1:176483480-176483502 TTTTTTTTTGAGATGAAGTCTGG + Intronic
917814763 1:178696672-178696694 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
917983752 1:180293904-180293926 TTTTTTTTTGAGATGAAGTCTGG + Intronic
918115021 1:181488512-181488534 TTTGCTTTTGATATGAAGTGTGG + Intronic
919071687 1:192763735-192763757 TGGCAATTTTATCTGAAGTCAGG - Intergenic
919287970 1:195589695-195589717 CTGTATTTTAATTTGAAGTCAGG - Intergenic
919492167 1:198218155-198218177 TTGTAGTATGATTTGAAGTCAGG - Intronic
920891442 1:209990876-209990898 TTGCAGTATAATTTGAAGTCAGG - Intronic
921851420 1:219936098-219936120 TTGAATATTGAAATGAAGTCTGG + Intronic
923269584 1:232343290-232343312 TTGTATTATGGTTTGAAGTCAGG - Intergenic
924852780 1:247847344-247847366 GTGCATTTGGATATGAATTGTGG - Intergenic
1064202572 10:13297463-13297485 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1064348094 10:14551196-14551218 TTGTTTTTTGAGATGAAGTTCGG + Intronic
1064351412 10:14580822-14580844 TTCCATCTTGGTATGAAGTTAGG - Intronic
1065095519 10:22277048-22277070 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1065567259 10:27025679-27025701 CTGCATTTAGAAATGAAGTGAGG - Intronic
1066067174 10:31770981-31771003 TTGCATTTCAACATGAAGTTTGG - Intergenic
1066280428 10:33912144-33912166 TTACAGTATAATATGAAGTCAGG + Intergenic
1066307490 10:34160725-34160747 TTACATGTTGGTAAGAAGTCTGG - Intronic
1066470994 10:35698174-35698196 TTTCTTTTTGAAATGGAGTCTGG + Intergenic
1066619568 10:37331352-37331374 TTGCACTATAATTTGAAGTCAGG - Intronic
1066636092 10:37502531-37502553 TTGCATTTTGAAAGTAAGTATGG - Intergenic
1066812298 10:39355864-39355886 TTGTAGTATAATATGAAGTCAGG + Intergenic
1067022791 10:42816357-42816379 TGGGATTTTGATGTGAAGTGCGG + Intronic
1067343174 10:45420214-45420236 TTAAATTTTGTTATGAAATCAGG + Intronic
1068156601 10:53206731-53206753 TTGCATTTTAATATGAGATTTGG - Intergenic
1068689592 10:59902403-59902425 TTTTTTTTTGAGATGAAGTCTGG + Intronic
1068721038 10:60246616-60246638 TTGCTGTTTGTTGTGAAGTCAGG + Intronic
1069403360 10:68073826-68073848 TAGTATTTTGATTTGAAATCTGG - Intronic
1070462902 10:76687788-76687810 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1070562479 10:77578358-77578380 TTGCTTCTTGAGATGAAGACAGG + Intronic
1071115671 10:82216370-82216392 TTGCAATTTGATATATACTCTGG + Intronic
1071302297 10:84265130-84265152 CAGCATTTTGATAAGAGGTCTGG + Intergenic
1071875931 10:89843225-89843247 TTGTAGTATGATTTGAAGTCAGG + Intergenic
1071968454 10:90877293-90877315 TTTTTTTTTGAAATGAAGTCTGG - Intronic
1072410103 10:95194025-95194047 TTGCTTTCTGATATGATGTCAGG - Intergenic
1072569834 10:96648804-96648826 TTGCATTTTGCTGCGAAGTATGG - Exonic
1072878105 10:99195943-99195965 CTGCAGTATAATATGAAGTCAGG - Intronic
1073619837 10:105035477-105035499 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1073751431 10:106531995-106532017 TGGCATTTATATATAAAGTCAGG - Intergenic
1074387881 10:113031497-113031519 TTTCCTTTTGAGATGGAGTCTGG + Intronic
1074554615 10:114476859-114476881 TTTCATTTTGACATTAAGTTTGG - Intronic
1074624778 10:115169603-115169625 TTGCAATTTCATATGAATTTTGG + Intronic
1075831173 10:125412901-125412923 TTGCATTTTCATATAAATTTTGG + Intergenic
1076373737 10:129970393-129970415 TTTAATTTTGTTATGAGGTCTGG - Intergenic
1076480752 10:130783778-130783800 GTGCATTTGGATGTGAAGTTTGG - Intergenic
1078184014 11:9036286-9036308 CTGCATTTAGAGAAGAAGTCTGG - Intronic
1078520252 11:12057264-12057286 TTACAATTTGATATGAAATTTGG - Intergenic
1078650144 11:13183417-13183439 ATGCAATTTGAAATGATGTCAGG + Intergenic
1079012413 11:16840258-16840280 GTGCATTTAGATATAAAGACAGG + Intronic
1079662042 11:23050899-23050921 TTGCAGTATAATTTGAAGTCAGG - Intergenic
1079823879 11:25165920-25165942 TTGCATTGTGTTTTGAAGTCAGG + Intergenic
1079852801 11:25558452-25558474 TTGCAATTTGAGATGAAATTTGG + Intergenic
1080173284 11:29332128-29332150 TCACATTGTGATATGAAGTTGGG - Intergenic
1080240516 11:30122074-30122096 ATGCATTTTGATCTGCTGTCTGG + Intergenic
1080258178 11:30316540-30316562 TTTCATTTGGATATGTAGTAGGG - Intergenic
1080601422 11:33824009-33824031 CTGCAGTATAATATGAAGTCAGG + Intergenic
1080714536 11:34787092-34787114 TTGCATTTTCATATTAATTTTGG - Intergenic
1081467753 11:43338763-43338785 TTCAATTTTAATATGAATTCAGG - Intronic
1081486699 11:43536235-43536257 TTGCAGTATAATTTGAAGTCAGG + Intergenic
1083108793 11:60385105-60385127 TTGCCTGTTGATTTCAAGTCTGG + Exonic
1083277420 11:61604886-61604908 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1083380800 11:62267052-62267074 TTGCTATTTAATATGAAGTATGG + Intergenic
1083613864 11:64016979-64017001 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1085432906 11:76471003-76471025 TTGTATATTGATATGAAGAATGG - Intronic
1085657199 11:78327268-78327290 TTGCATTTTAATATGAAATGGGG + Intronic
1085888447 11:80548540-80548562 TTTCTTTTTGAGATGGAGTCTGG - Intergenic
1086010648 11:82099019-82099041 TTTCATTGTGATATGGAGACAGG - Intergenic
1086813607 11:91341149-91341171 TTGAAGTATAATATGAAGTCTGG - Intergenic
1087421840 11:97938013-97938035 TTGCATTTTGAAATGTTTTCAGG - Intergenic
1087612317 11:100449061-100449083 TTGTATTTTGTTATGAAGTATGG + Intergenic
1087813591 11:102634313-102634335 TTGCATTTTGAAATGTTTTCGGG + Intergenic
1088483168 11:110315359-110315381 TTCCATTTTTATATGAATTTTGG + Intergenic
1088988110 11:114927864-114927886 TTCCATTTTGATATGTAGCAAGG + Intergenic
1089507477 11:118973427-118973449 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1089584395 11:119501207-119501229 CTGCATTTTGATAGGAAGGCTGG - Intergenic
1090710653 11:129382089-129382111 TTGCACTTTGTTTTGAGGTCAGG + Intronic
1090894412 11:130957507-130957529 TTGCATTTCCATATGAATTTTGG + Intergenic
1092368365 12:7895932-7895954 TTTTATTTTGAGATGGAGTCTGG + Intergenic
1092368877 12:7899842-7899864 TTTTATTTTGACATGGAGTCTGG - Intergenic
1092460897 12:8685340-8685362 CAGCATTTTGAAATGAAGTATGG - Intronic
1092501198 12:9049960-9049982 ATGCATCTTGATTTGAAGTGAGG - Intergenic
1092852957 12:12647521-12647543 TTACATTTTGATATGAGATTTGG + Intergenic
1093000612 12:13991976-13991998 TGGCATTTGGATATGAACTCAGG + Intergenic
1093756062 12:22853430-22853452 TTGAATTCTGAAATAAAGTCTGG + Intergenic
1094068095 12:26382860-26382882 TGACATTTTAATATGAAGTTTGG - Intronic
1095040572 12:37435902-37435924 TTGCATTTTGAAATGGACCCAGG - Intergenic
1095041252 12:37443568-37443590 TTGTAGTATGATTTGAAGTCAGG - Intergenic
1095122908 12:38440632-38440654 TTGCATTTTTATAAGATCTCAGG - Intergenic
1095580801 12:43795491-43795513 TTCCATGTTGATATAAAGTAGGG - Exonic
1095903724 12:47355588-47355610 AGGCATTTGGATATGAAGTCTGG + Intergenic
1096582443 12:52595480-52595502 TTGAATTTAGAAATGAAGTCAGG + Intronic
1096662484 12:53135649-53135671 TTGCATTTCCATATGAATTTTGG + Intergenic
1097342663 12:58456556-58456578 GTGCATCTTGATCTGAATTCTGG + Intergenic
1097490526 12:60263734-60263756 TTGTAGTTTAATTTGAAGTCTGG + Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1097568816 12:61306008-61306030 CTGCAGTGTGATTTGAAGTCAGG + Intergenic
1097650186 12:62287994-62288016 TTGCAGTTTAATTTGAAGTTGGG + Intronic
1097714980 12:62956249-62956271 TTGTTTTTTGAGATGAGGTCTGG + Intergenic
1098099159 12:66994928-66994950 TTGCATTATGTTTTGAAATCAGG - Intergenic
1098925186 12:76341784-76341806 TTACATTTTTAAATAAAGTCAGG + Intergenic
1099369961 12:81816961-81816983 TTGAAATATGATTTGAAGTCAGG - Intergenic
1099792096 12:87349183-87349205 TTGCATTTTAACAGGAAGTGTGG + Intergenic
1099980721 12:89598869-89598891 TAGCATTTTGAGATGAAGTGGGG + Intronic
1100428553 12:94509718-94509740 TTGCAATTTGATATGAGATTTGG - Intergenic
1100920661 12:99482433-99482455 TTGCAGTATAATTTGAAGTCTGG + Intronic
1101187712 12:102297073-102297095 TTGTATTATAATTTGAAGTCAGG + Intergenic
1102791576 12:115650602-115650624 TTAGATTTTGATGTGAAGTTAGG - Intergenic
1103135838 12:118506869-118506891 TTGCAATTTGACATGAGGTTTGG - Intergenic
1103168729 12:118794519-118794541 TTGCATTATATTTTGAAGTCAGG + Intergenic
1103210926 12:119165749-119165771 GAGCATTCTGATATGAAGCCAGG + Intergenic
1105438384 13:20396291-20396313 TTGCATTTTGAAAAGATGACTGG - Intergenic
1105656383 13:22444501-22444523 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1105809139 13:23979450-23979472 TTGCATATTCATAAGAAGGCGGG - Intergenic
1107230782 13:38107553-38107575 TAGCATTTTGATGTGCTGTCAGG - Intergenic
1107333325 13:39325703-39325725 ATATATTTTGGTATGAAGTCAGG - Intergenic
1107919824 13:45194062-45194084 TTTATTTTTGATATGAAATCAGG + Exonic
1108785653 13:53898277-53898299 TTGTATTATAATTTGAAGTCAGG - Intergenic
1108836302 13:54553950-54553972 TTGCAGTTTAATTTGAAGTTGGG + Intergenic
1109054218 13:57526493-57526515 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1109372391 13:61440327-61440349 TTGCAGTATAATTTGAAGTCAGG - Intergenic
1109733994 13:66456799-66456821 TTTCATTTTGCTATGGAGTATGG + Intronic
1109956725 13:69578173-69578195 ATGCATTTTACTTTGAAGTCAGG - Intergenic
1111574376 13:90132225-90132247 TTTCTTTTTGAGATGAAGTCTGG - Intergenic
1111768908 13:92571505-92571527 TTTCATATTTATATGAAATCTGG - Intronic
1113181477 13:107632786-107632808 TTGCATTTTGAAATGAATGAGGG + Intronic
1113503965 13:110800255-110800277 TTCTTTTTTGATATGGAGTCTGG + Intergenic
1113658313 13:112085141-112085163 TTGCATTTCCATATAAAGTTTGG + Intergenic
1113757231 13:112821272-112821294 TTGCATTTTGATACTAACTCTGG + Intronic
1114432963 14:22678351-22678373 TTACAATTTGAAATGAAATCTGG - Intergenic
1114852620 14:26399592-26399614 TTGCATTTCCATATCAATTCTGG + Intergenic
1115270707 14:31549197-31549219 TTGTAGTATGATTTGAAGTCAGG + Intronic
1115598059 14:34928449-34928471 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1115861686 14:37693681-37693703 TTGCAGTATAATTTGAAGTCAGG - Intronic
1116265105 14:42677901-42677923 CTGGATTTTGATATGAAGTCTGG + Intergenic
1116305196 14:43244933-43244955 TTGCAGTATAATTTGAAGTCAGG + Intergenic
1116625961 14:47263772-47263794 TTTCATTTTGATATAAAGAATGG - Intronic
1116935349 14:50734099-50734121 TTTCTTTTTGAGATGGAGTCCGG + Intronic
1117750097 14:58912503-58912525 TTGCATTTTGTAATACAGTCAGG + Intergenic
1118675377 14:68179033-68179055 TGGCATTTTGATATAGAGGCAGG + Intronic
1120077778 14:80179716-80179738 TTTTGTTTTGAGATGAAGTCTGG + Intergenic
1120162194 14:81157958-81157980 TTGCAGTGTAATTTGAAGTCAGG - Intergenic
1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG + Intronic
1122004286 14:98689180-98689202 TTACATTTTGACATGAAATTTGG - Intergenic
1122480554 14:102044561-102044583 GTGCATTTGGAAATGATGTCAGG - Intronic
1122614088 14:103004855-103004877 TTTCTTTTTGAGATGGAGTCTGG - Intronic
1123423945 15:20153535-20153557 TGGGATTTTGACATGAAGTGCGG + Intergenic
1123533166 15:21160064-21160086 TGGGATTTTGACATGAAGTGCGG + Intergenic
1124072586 15:26409710-26409732 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1124433234 15:29625405-29625427 TCTCTTTTTGAGATGAAGTCTGG + Intergenic
1124512423 15:30338654-30338676 TTGCATTTTTTTATGGTGTCTGG - Intergenic
1124730491 15:32192097-32192119 TTGCATTTTTTTATGGTGTCTGG + Intergenic
1125096410 15:35857857-35857879 TTGCATTTGGATATGAACACTGG - Intergenic
1125225630 15:37392228-37392250 TTGTATTATAATTTGAAGTCAGG + Intergenic
1127004011 15:54545033-54545055 TTGCAGTTTAGTTTGAAGTCAGG - Intronic
1127669030 15:61176903-61176925 TTACATGTTAATTTGAAGTCAGG - Intronic
1129900211 15:79142009-79142031 TTACAATTTGATATGAAATTTGG + Intergenic
1129966525 15:79740753-79740775 TTGGATGTAGATGTGAAGTCTGG + Intergenic
1130068161 15:80623264-80623286 TTGCATTTGGATATGGTGTGGGG - Intergenic
1131574162 15:93569751-93569773 CTGAAATTTGAAATGAAGTCAGG + Intergenic
1131712646 15:95072933-95072955 TTGCATTTTGCTATCAAATCAGG + Intergenic
1132341389 15:101080495-101080517 TTGTGTTTTGAGATGGAGTCTGG + Intergenic
1134604652 16:15560779-15560801 TTTTATTTTGAGATGGAGTCTGG - Intronic
1134796755 16:17046227-17046249 TTGCATTATGGTTTGAAATCAGG + Intergenic
1135115675 16:19721595-19721617 TTTTTTTTTGAGATGAAGTCTGG + Intronic
1135338687 16:21627939-21627961 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1136860926 16:33702351-33702373 TGGGATTTTGACATGAAGTGCGG - Intergenic
1137357612 16:47781592-47781614 TTGCCTTTTCATATGAGGTTGGG - Intergenic
1137517356 16:49158381-49158403 GTGCATTTTGGAATGAAGCCTGG - Intergenic
1137750829 16:50859949-50859971 TTCCATTTGGAAATGAGGTCTGG - Intergenic
1138861071 16:60758208-60758230 TTGAAGTTTCATTTGAAGTCAGG - Intergenic
1138990283 16:62382602-62382624 GTGCATTTTGTTCTGAATTCAGG - Intergenic
1139522197 16:67490203-67490225 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1140174698 16:72645542-72645564 TTTTTTTTTGACATGAAGTCTGG - Intergenic
1140505373 16:75468597-75468619 TTTCTTTTTGAGATGGAGTCTGG - Intergenic
1140775862 16:78248438-78248460 TTACATTTGGACATGAAGGCTGG + Intronic
1140816506 16:78626140-78626162 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1141300114 16:82807173-82807195 TTGCATTTTTATATGACATTTGG - Intronic
1141485722 16:84338959-84338981 CTGTAGTATGATATGAAGTCAGG - Intergenic
1141542054 16:84732456-84732478 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1142646928 17:1320159-1320181 TTGCATTTTTATATAAATTGTGG - Intergenic
1142659389 17:1417341-1417363 TTGCTTTTTGAAACGGAGTCTGG + Intergenic
1142912861 17:3110862-3110884 TTAGTTTTTGAGATGAAGTCTGG - Intergenic
1143151997 17:4813019-4813041 TTGGTTTTTGAGATGGAGTCTGG + Intronic
1143700740 17:8658172-8658194 TTTCTTTTTGAGATGGAGTCTGG - Intergenic
1143810373 17:9466899-9466921 TTTTCTTTTGAGATGAAGTCTGG + Intronic
1144276778 17:13677529-13677551 TTGTAGTATGATTTGAAGTCTGG - Intergenic
1146012012 17:29203329-29203351 TTCCATGTTGATATAAAGTAGGG - Intergenic
1146544886 17:33729424-33729446 TTACATTTTGACATGAGATCTGG + Intronic
1146940613 17:36841806-36841828 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1147231274 17:39020304-39020326 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1147270749 17:39269202-39269224 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1147510744 17:41066876-41066898 TTGCATAGTGGCATGAAGTCTGG - Intergenic
1148512233 17:48181101-48181123 TTGCATTTTGAAATGAAAGTTGG - Intronic
1149837047 17:59922568-59922590 TTTTTTTTTGAGATGAAGTCAGG + Intronic
1149942760 17:60887763-60887785 TTGTTTTTTGAAATGAATTCAGG + Intronic
1150632688 17:66891085-66891107 TTGCATCTTGATAGGATGTTTGG - Intergenic
1150914196 17:69419900-69419922 TTTTTTTTTGAGATGAAGTCTGG - Intronic
1151154211 17:72113493-72113515 AAGCATTTTGATATTTAGTCAGG - Intergenic
1151284322 17:73099005-73099027 TTGTTTTTTGATATGAAGTCTGG - Intergenic
1151459396 17:74245719-74245741 CTGCATTTTAATAGGAAGCCGGG + Intronic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1153017837 18:599934-599956 TTTTTTTTTGAGATGAAGTCTGG - Intronic
1153178351 18:2404731-2404753 TTGCACCTTAATATGAACTCTGG + Intergenic
1153367956 18:4280471-4280493 ATATATTGTGATATGAAGTCAGG - Intronic
1153844227 18:9033946-9033968 TTGCATTTCAATATGAATTTGGG - Intergenic
1154421384 18:14231704-14231726 CTGCATTTAGAAATGAAGTGGGG + Intergenic
1155727696 18:29109428-29109450 TTGCAATATAATTTGAAGTCAGG + Intergenic
1155863720 18:30937367-30937389 TTGCATTATAATTTGAGGTCAGG + Intergenic
1156178165 18:34572020-34572042 CTGAATTTTGATATGATGTCAGG - Intronic
1156567901 18:38217066-38217088 TTTCTTTTTGAGATGGAGTCTGG - Intergenic
1156904014 18:42333284-42333306 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1156948286 18:42862109-42862131 TTGCAATTTGAGATGAATTTTGG - Intronic
1156965499 18:43086578-43086600 TCACATTTTAATATGAAGGCTGG + Intronic
1157077377 18:44480237-44480259 TTACAATTTGAAATGAGGTCTGG - Intergenic
1157356656 18:46941325-46941347 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1158027488 18:52918263-52918285 TTGCATTTGGATATGAATAGTGG + Intronic
1158762544 18:60407476-60407498 TAGCCTTTTAGTATGAAGTCAGG - Intergenic
1158861489 18:61597058-61597080 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1159190894 18:65040847-65040869 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1159760131 18:72415531-72415553 TTGTATTATAATTTGAAGTCAGG - Intergenic
1159868836 18:73737717-73737739 TTTCATTTTGAAATGAACTGTGG + Intergenic
1161403550 19:4079647-4079669 TTATATTTTGAGATGGAGTCTGG - Intergenic
1161831407 19:6607287-6607309 TTGTTTTTTGAGATGAAGTCTGG - Intergenic
1165303497 19:34988508-34988530 TTCCATTTTGCTCTGCAGTCAGG - Intergenic
1165959336 19:39521319-39521341 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1167050239 19:47073558-47073580 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1167233630 19:48300358-48300380 TTGCATTATGGTATGAGGTAGGG - Intronic
1167957746 19:53080806-53080828 TTGCAATATGGTTTGAAGTCAGG - Intronic
925677135 2:6374444-6374466 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
925696021 2:6579722-6579744 TTACATTTTGACATGAGGTTTGG + Intergenic
925736892 2:6971482-6971504 TTGCATTTTGAGGTGGGGTCTGG + Intronic
927237753 2:20890713-20890735 TTGCATTTCCATATGAATTTTGG + Intergenic
927425060 2:22972271-22972293 TTGCAGTATAATTTGAAGTCAGG - Intergenic
927573158 2:24177424-24177446 TTGCTTTTTGAGACAAAGTCTGG - Intronic
928475751 2:31625766-31625788 TTGCAGTATAATTTGAAGTCAGG + Intergenic
928707999 2:33972163-33972185 TTGCATTTAGATATTAAATGAGG - Intergenic
929542275 2:42831484-42831506 TTTCTTTTTGAGACGAAGTCAGG + Intergenic
929649875 2:43668042-43668064 TTGTTTTTTGAGATGAAGTCCGG + Intronic
931967979 2:67554374-67554396 TTGCATTCTCATCTGAAGCCAGG - Intergenic
932148759 2:69348767-69348789 TTGCCTTTTGATATCAATTTTGG - Intronic
932513515 2:72320543-72320565 TTTCAATATGATATGAAGTATGG - Intronic
932720158 2:74132907-74132929 TTTCTTTTTGATACGGAGTCTGG + Intronic
933352039 2:81166077-81166099 TTACATTTTGAGTTGAAGTCAGG - Intergenic
935324446 2:101923743-101923765 TTACAATTTGACATGAAATCTGG - Intergenic
936134938 2:109883107-109883129 TTGTATTATAATTTGAAGTCTGG + Intergenic
936209759 2:110488378-110488400 TTGTATTATAATTTGAAGTCTGG - Intergenic
936428949 2:112443628-112443650 TTGTATTATAATTTGAAGTCTGG - Intergenic
936749940 2:115629808-115629830 TTGTAGTATGATTTGAAGTCAGG + Intronic
936955353 2:118017001-118017023 TTACATTTTGACATGAGATCTGG - Intergenic
937034711 2:118771429-118771451 TTGGATTTGGTTATGCAGTCTGG - Intergenic
937186343 2:120047066-120047088 TTGTAGTATGGTATGAAGTCAGG + Intronic
937286426 2:120756059-120756081 TTGCATTTTCATATGAATTTTGG + Intronic
938306415 2:130259369-130259391 TTGTATTTTGCTTTGAAATCAGG - Intergenic
938897274 2:135764825-135764847 TTTGTTTTTGAGATGAAGTCTGG + Intronic
939305630 2:140406928-140406950 TTGCAATATGATTTGAAGTCTGG - Intronic
939396865 2:141641888-141641910 TTTTACTTTGATATGAAGCCAGG + Intronic
939831228 2:147073603-147073625 TTGTAGTATAATATGAAGTCAGG + Intergenic
940016024 2:149105293-149105315 TTGCATTTTGATATGGATTTTGG + Intronic
940365871 2:152848052-152848074 TTGCAGTATAATTTGAAGTCCGG + Intergenic
940488143 2:154322893-154322915 TGGCATTTTGATGTGACGGCTGG + Intronic
940494642 2:154410458-154410480 TTGAATGTGGATATGATGTCTGG - Intronic
941710124 2:168703544-168703566 TTGTTTTTTGAGATGGAGTCTGG - Intronic
942762444 2:179415494-179415516 TTGTAGTATGATTTGAAGTCAGG - Intergenic
942898299 2:181084608-181084630 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
943798042 2:192022952-192022974 TTTCCTTTTGTTATGAAGTATGG + Intronic
944742130 2:202622877-202622899 TTTCTTTTTGAGATGGAGTCTGG + Intergenic
944771172 2:202915480-202915502 TTTCTTTTTGAGATGGAGTCTGG + Intronic
945887278 2:215389408-215389430 TTCCATTTTGATACACAGTCAGG + Intronic
946069915 2:217025234-217025256 TTGCATTTTGATGTGGAGAGGGG - Intergenic
946632699 2:221688263-221688285 TGGAATTTTGCTGTGAAGTCTGG - Intergenic
946673422 2:222131025-222131047 GTGCCTTTTCATAGGAAGTCTGG + Intergenic
947200051 2:227607116-227607138 TTTCTTTTTGAGATGGAGTCTGG + Intergenic
947570646 2:231231698-231231720 TTTTTTTTTGAGATGAAGTCTGG + Intronic
947745645 2:232506129-232506151 TTGCATTAAGATATTAGGTCGGG + Intergenic
948499102 2:238378772-238378794 TCGCAGTTTGATCTGAAGCCGGG + Intronic
1169310904 20:4538859-4538881 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1169438514 20:5614319-5614341 ATTCATTTTGAGATGGAGTCTGG - Intergenic
1169987767 20:11464950-11464972 TTGTAGTATAATATGAAGTCAGG + Intergenic
1170285500 20:14704034-14704056 TTGCTTTTTTAAAAGAAGTCAGG - Intronic
1170543807 20:17415768-17415790 TTGTATTATGGTTTGAAGTCAGG - Intronic
1170925059 20:20715182-20715204 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1171726818 20:28630872-28630894 TTGTAATTTAATTTGAAGTCAGG - Intergenic
1171751443 20:29053740-29053762 TTGTAATTTAATTTGAAGTCAGG + Intergenic
1171790887 20:29524137-29524159 TTGTAATTTAATTTGAAGTCAGG - Intergenic
1172594845 20:36143794-36143816 TTGCATTTTCAAAGGAAATCAGG + Intronic
1173352444 20:42257475-42257497 TTACATTTTGACATGAGGTTTGG - Intronic
1173635785 20:44556372-44556394 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1174464803 20:50708920-50708942 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1174477045 20:50802860-50802882 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1175375183 20:58519275-58519297 TAGCATTATGATTTGAAGTCAGG - Intergenic
1176006003 20:62862544-62862566 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1176275239 20:64262240-64262262 TTTCTTTTTGAGATGGAGTCTGG - Intronic
1176313336 21:5217204-5217226 TTGTAATTTAATCTGAAGTCAGG - Intergenic
1176900773 21:14439256-14439278 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1176990396 21:15489610-15489632 TTGAATTTTGATAGTAATTCAGG - Intergenic
1177261533 21:18735223-18735245 CTGCAGTGTGATTTGAAGTCAGG + Intergenic
1178192718 21:30304482-30304504 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1178891153 21:36522242-36522264 ATGCATTTTCACATGAAGTGGGG - Intronic
1179454041 21:41486309-41486331 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1180666403 22:17516470-17516492 TTGCAATTTGAGATGAGCTCTGG - Intronic
1181137650 22:20780078-20780100 TTGGTTTTTGATATGAAGGCAGG - Exonic
1181284877 22:21744726-21744748 TTGCTTTTTGAGATGGAGTCTGG - Intergenic
1181356908 22:22302982-22303004 TGGGATTTTGACATGAAGTGCGG + Intergenic
1181868649 22:25880014-25880036 TTACAATTTGATATGAGGTTTGG + Intronic
1182539759 22:31032441-31032463 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1182778315 22:32847505-32847527 TTGCAGTCAGACATGAAGTCAGG - Intronic
1182815899 22:33163318-33163340 TTACATTTTAAAATGAAGTGTGG + Intronic
1182984556 22:34704296-34704318 TTGCATTGTGATCTGAAGATGGG - Intergenic
1184597311 22:45521995-45522017 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1184619061 22:45660431-45660453 TTATTTTTTGAGATGAAGTCTGG + Intergenic
1185378376 22:50493807-50493829 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
949120336 3:376326-376348 TTGCATTTGAACATGAAGCCTGG - Intronic
950180709 3:10911277-10911299 CTGCATTTTGATTTGAGCTCTGG + Intronic
950236678 3:11327824-11327846 TTGCATTTTAATAAGAACCCAGG - Intronic
950819154 3:15739447-15739469 TTTCATTTTCATATGTAGTTTGG - Intronic
951223497 3:20094405-20094427 TTGCAATTTGAGATGATGTTTGG + Intronic
951255449 3:20444346-20444368 CTGCAGTATGATTTGAAGTCAGG - Intergenic
951783554 3:26391546-26391568 TTGCATATTGATATTCTGTCTGG + Intergenic
951802730 3:26614471-26614493 TTGCATTTTGAGAGAATGTCAGG + Intergenic
951937232 3:28035112-28035134 TTGCATTTAGAAATGTAATCAGG + Intergenic
951973725 3:28479333-28479355 TTGCATTTTGAAATAAGTTCAGG + Intronic
952518985 3:34135974-34135996 TTGTATTATCATTTGAAGTCAGG - Intergenic
952549937 3:34465458-34465480 TTGCACTTTGAAAGGAAGTGGGG + Intergenic
952874225 3:37929183-37929205 TTGTAATTTGTTTTGAAGTCAGG + Intronic
953353983 3:42238746-42238768 TTGCATTTTGAAGTTAAGTAAGG - Intergenic
953736083 3:45495054-45495076 TTTTATTTTGAGATGGAGTCTGG - Intronic
953870543 3:46622851-46622873 CTGCATTTTCATATGAATTTTGG + Intronic
954045775 3:47928956-47928978 TTGCATTTTTATATAAATTATGG - Intronic
954603738 3:51892809-51892831 TTCCTTTTTGAGATGGAGTCTGG - Intergenic
955249506 3:57264853-57264875 TAGCATTGTAATTTGAAGTCAGG + Intronic
955394209 3:58545368-58545390 TTGCAGTATAATTTGAAGTCAGG + Intergenic
955444128 3:58990938-58990960 TTGCATTCTGGTATGGAGCCAGG - Intronic
955445295 3:59003648-59003670 TTCCATTTTCATATCATGTCTGG - Intronic
955805407 3:62728891-62728913 TTGCAATTTGGAATGAAATCCGG + Intronic
955860058 3:63319329-63319351 TTGTATTATAATTTGAAGTCAGG + Intronic
956356132 3:68394539-68394561 TTGCAGTATGGTTTGAAGTCAGG - Intronic
957242645 3:77678519-77678541 TTGGATTTTCATAAGAATTCTGG - Intergenic
957322839 3:78654147-78654169 TTGCATCTTGATAAGAAAACTGG + Intronic
957623881 3:82632734-82632756 TTGCATTCTGATAGGAAATTTGG - Intergenic
957720619 3:83993281-83993303 TTGCAGTATAATTTGAAGTCAGG + Intergenic
957748175 3:84373094-84373116 TTCTTTTTTGAGATGAAGTCTGG + Intergenic
957889161 3:86332733-86332755 TTGCATTTTCATTTGGAGTTTGG + Intergenic
958216701 3:90591211-90591233 TTCCATTTTGATATTTAGTGCGG - Intergenic
958558783 3:95715480-95715502 TTGCATTTAAATGTCAAGTCAGG - Intergenic
958839776 3:99190035-99190057 TTGCAGTATAATATAAAGTCAGG - Intergenic
959105524 3:102060337-102060359 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
959124541 3:102274507-102274529 TTGCAGCATGATGTGAAGTCAGG + Intronic
959128679 3:102323261-102323283 TTGCATTTTTATGTGGAGTGTGG + Intronic
959463620 3:106657541-106657563 TTGCAGTATAATTTGAAGTCAGG - Intergenic
959818284 3:110702254-110702276 TTGCAGTATAATTTGAAGTCAGG + Intergenic
959911342 3:111767017-111767039 TTTTTTTTTGAGATGAAGTCAGG - Intronic
959949961 3:112168837-112168859 TGGCATATTGATCTGAAGACAGG + Intronic
960316180 3:116179769-116179791 TTACATTTTGACATGAAATTTGG + Intronic
960536691 3:118823067-118823089 TTTTATTTTGAGATGGAGTCTGG - Intergenic
961230981 3:125308562-125308584 TTGCATTTTCATATAAAGTATGG - Intronic
961974932 3:131013649-131013671 TTGTACTTTAGTATGAAGTCTGG - Intronic
962037817 3:131671333-131671355 TAGCATTTTCATATAAAGTTGGG - Intronic
962406588 3:135105801-135105823 TTGCATTTTGATATGCTTCCGGG - Intronic
963352129 3:144164696-144164718 TTGCATTTTGAGATGAGATTTGG + Intergenic
963650058 3:147968193-147968215 TTGCATAATGAAACGAAGTCAGG + Intergenic
965108790 3:164393975-164393997 TTGCAATTACATATGAATTCTGG - Intergenic
965498085 3:169423055-169423077 TTGCATTTTAAGAAGAACTCAGG - Intronic
965526622 3:169726550-169726572 TTGTAGTATGATTTGAAGTCAGG + Intergenic
965697213 3:171421741-171421763 TTTTTTTTTGAGATGAAGTCTGG + Intronic
965966738 3:174500866-174500888 TTTTTTTTTGATATGGAGTCTGG + Intronic
966239120 3:177736105-177736127 TATCATTTTTATATGAAGACAGG - Intergenic
966705481 3:182909231-182909253 TTGCCTTTTGAAATAAATTCTGG - Intronic
967360852 3:188629817-188629839 TTGCAGTTTAATTTGAAGTCAGG - Intronic
969675393 4:8611599-8611621 TTGGCTTTGGAGATGAAGTCGGG + Intronic
969828289 4:9775478-9775500 TTGCAATTTAACATGAAATCTGG - Intronic
970053437 4:11943250-11943272 TTGCATTTTTATATGAATTTTGG + Intergenic
970460163 4:16266458-16266480 TTGGTTTTTGACATGGAGTCTGG - Intergenic
970623386 4:17849866-17849888 TTGCAGTATAATTTGAAGTCAGG - Intronic
971914571 4:32851304-32851326 TTGCAATTTGAGATGAAATTTGG + Intergenic
971937886 4:33176198-33176220 TTGCATTCTTATAGGAAGGCAGG - Intergenic
972227585 4:37031575-37031597 TTGAATTTAGATATAAAGTTTGG + Intergenic
972510812 4:39767338-39767360 TTGTTTTTTGAGATGGAGTCTGG + Intronic
972619561 4:40733765-40733787 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
972772853 4:42214497-42214519 TTTCTTTTTGAGATGGAGTCTGG + Intergenic
972923168 4:43968649-43968671 TTTGTGTTTGATATGAAGTCTGG + Intergenic
972996740 4:44888653-44888675 TTGCAGTGTAATTTGAAGTCAGG + Intergenic
973766194 4:54165157-54165179 TTACATTTTGACATGAATTTTGG + Intronic
974226827 4:59057432-59057454 TTGCATTCTCATATGAATTTTGG + Intergenic
974367095 4:60963953-60963975 TTTTTTTTTGATATGGAGTCTGG - Intergenic
974499150 4:62675828-62675850 TTATGTTTTGATATTAAGTCTGG + Intergenic
975316862 4:72964006-72964028 TTGCAGTATAATTTGAAGTCAGG - Intergenic
975378745 4:73674054-73674076 TTTTATTTTGAGATGGAGTCTGG - Intergenic
975782163 4:77850656-77850678 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
975792952 4:77974525-77974547 TTTCTTTTTGAGATGGAGTCTGG + Intergenic
976574147 4:86649632-86649654 TTGTATTATAATTTGAAGTCAGG + Intronic
976942502 4:90720718-90720740 CTTCATTTTGATATGAAGAAAGG - Intronic
977139259 4:93346702-93346724 TTGCATTTTTATCTGAAATTCGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977923351 4:102670141-102670163 TTTTTTTTTGATATGGAGTCTGG - Intronic
978305765 4:107327017-107327039 TTGCAATATAATTTGAAGTCAGG + Intergenic
978460412 4:108945674-108945696 TTGTTTTTTGAGATGGAGTCTGG + Intronic
978518177 4:109591708-109591730 TTGTTTTTTGAAATGGAGTCTGG + Intronic
978877834 4:113663655-113663677 TTGAATTTTGTTATGGAGACAGG + Intronic
978884345 4:113748527-113748549 TTGCTTTTTGCTATGATGACTGG - Intronic
979302502 4:119102963-119102985 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
979316216 4:119266916-119266938 TTGTTGTTTTATATGAAGTCAGG + Intronic
979506627 4:121504490-121504512 TTGCAGTATAATTTGAAGTCGGG + Intergenic
979804511 4:124954580-124954602 TTGCCTCTTTATATGAAGCCAGG + Intergenic
979930370 4:126622672-126622694 TTGTATTATGTTATGAAGTTGGG - Intergenic
979972027 4:127147427-127147449 TTGCATTTTCACATGAATTCTGG + Intergenic
981187443 4:141820417-141820439 TTGCAGTATAATTTGAAGTCAGG - Intergenic
982146788 4:152403464-152403486 TTTTTTTTTGAGATGAAGTCTGG - Intronic
982510186 4:156272965-156272987 TTGCAGTATAATTTGAAGTCAGG + Intergenic
982530438 4:156534710-156534732 TAGAATTTTGACATGATGTCTGG - Intergenic
982843212 4:160219205-160219227 TTACATTTTAATATGAAGTTTGG + Intergenic
983384230 4:167037468-167037490 TTCTTTTTTGAGATGAAGTCTGG - Intronic
983423071 4:167545678-167545700 TTGTATTATAATTTGAAGTCAGG + Intergenic
983746717 4:171209742-171209764 TTGTAGTTTGGTTTGAAGTCAGG + Intergenic
984091884 4:175385665-175385687 TTGGCTTTTGATATTTAGTCTGG - Intergenic
984229415 4:177076111-177076133 TTCTATTTTGATATAATGTCTGG + Intergenic
984263482 4:177469979-177470001 TTTTTTTTTGATATGGAGTCTGG + Intergenic
984317743 4:178149010-178149032 TTACATTTTGATATCATTTCAGG + Intergenic
984392086 4:179148936-179148958 TTGCATATTGATAATAAGTATGG + Intergenic
984449952 4:179887030-179887052 TTGCAGTATAATTTGAAGTCAGG - Intergenic
984643832 4:182199408-182199430 TTGTTTTTTGAGATGGAGTCTGG - Intronic
984944280 4:184959114-184959136 TTGCATTTTGGAATGAACCCAGG + Intergenic
985433828 4:189908097-189908119 TTGTAATTTAATTTGAAGTCAGG + Intergenic
985497934 5:220573-220595 TTGTTTTTTGATATGAAACCTGG + Intronic
986885372 5:12227110-12227132 TTGTATTTTGAGAGGGAGTCAGG - Intergenic
987514440 5:18887968-18887990 TTACACTTTGAGATGAAGTTTGG + Intergenic
987823604 5:22998418-22998440 ATGCATTTTGTTAGCAAGTCAGG + Intergenic
987879544 5:23725336-23725358 TTGAATATTGATAATAAGTCAGG - Intergenic
988072884 5:26317103-26317125 TTGCATTATAATTTGAAGTTTGG + Intergenic
988368413 5:30333498-30333520 TTGTATTATAATTTGAAGTCAGG - Intergenic
988912749 5:35861243-35861265 TTAAATTCTGATATGAAGTTGGG - Intronic
989628342 5:43454801-43454823 TTGCATTTTTATATCAATTAAGG - Intronic
990025552 5:51183352-51183374 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
990081093 5:51914664-51914686 TTGCTTTTTCATATGTAGTGTGG - Intergenic
990182725 5:53180553-53180575 TTACAATTTGATATGAAATTTGG - Intergenic
990400688 5:55434518-55434540 TAGCCTTGTAATATGAAGTCAGG - Intronic
990831140 5:59959446-59959468 TTGCAGTATAATTTGAAGTCAGG - Intronic
991327170 5:65447262-65447284 TTAAATTTTCAGATGAAGTCAGG - Intronic
992259087 5:74952234-74952256 TTGCATTTTAACATGAACTAAGG + Intergenic
992264076 5:75000365-75000387 TTCCATTGTGATCTGAAATCAGG - Intergenic
992276299 5:75123526-75123548 TTGCAGTATAATTTGAAGTCAGG - Intronic
992353310 5:75953330-75953352 TCACATTTTGACATGAAGTTTGG + Intergenic
992404998 5:76448460-76448482 TTTCATCTTGATATCAGGTCTGG - Intronic
992780629 5:80124042-80124064 TTCTATTTTGATATCTAGTCTGG - Intronic
992828562 5:80571948-80571970 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
992853332 5:80833906-80833928 TTGAATTATGATATAAAGCCAGG + Intronic
993034769 5:82744860-82744882 TTACAATTCGATATGCAGTCTGG - Intergenic
994125209 5:96161607-96161629 TTGCATTTCCATATGAATTTAGG + Intergenic
994285796 5:97964471-97964493 TTGCATTTCCATATAAATTCTGG + Intergenic
994466805 5:100145319-100145341 TTGTATTTAAATATGAAGTGAGG - Intergenic
994602156 5:101920478-101920500 TTGCATTTTCAAATGTAGTTTGG - Intergenic
995347839 5:111141106-111141128 TTGTAGTATGATTTGAAGTCAGG - Intergenic
997370425 5:133356364-133356386 CTGGATTTAGAGATGAAGTCTGG + Intronic
997909890 5:137861395-137861417 TTGTTTTTTGAGATGTAGTCTGG + Intergenic
998311290 5:141135657-141135679 TTGCAGCTTGATATAAAGACCGG + Exonic
1000062046 5:157666715-157666737 TTTTGTTTTGAGATGAAGTCTGG + Intronic
1000157798 5:158568941-158568963 TTGCAATTTGATATGAGATTTGG - Intergenic
1000262514 5:159601381-159601403 TTGGCTTTTGATATGACCTCGGG + Intergenic
1000828630 5:166076303-166076325 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1001112029 5:168904608-168904630 TAGCATTTTGCAGTGAAGTCTGG - Intronic
1001730432 5:173950640-173950662 ATGCATTATCAAATGAAGTCTGG - Intronic
1002012391 5:176293734-176293756 TTTTTTTTTGAGATGAAGTCTGG - Intronic
1002111767 5:176919948-176919970 TTGTATTTTGGTATGAATTTTGG + Intronic
1002994132 6:2267145-2267167 TTTCATTTTTATAGGAATTCTGG - Intergenic
1003213432 6:4088328-4088350 TTTTTTTTTGAGATGAAGTCTGG + Intronic
1003651093 6:7961161-7961183 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1003671091 6:8160971-8160993 TTTGTTTTTGAGATGAAGTCTGG + Intergenic
1003971969 6:11308379-11308401 TTTTTTTTTGATACGAAGTCTGG + Intronic
1004292016 6:14376020-14376042 TTTCATTTTGTTAAAAAGTCAGG - Intergenic
1006821065 6:36895568-36895590 CTGCATTTAGATGAGAAGTCAGG - Intronic
1009244875 6:61224698-61224720 TTTCATTTTGAAATTAATTCGGG + Intergenic
1009526195 6:64749190-64749212 TTTCATTTTGATAAGAACTAGGG - Intronic
1009685853 6:66955888-66955910 TTACAATTTGATATGAAATTTGG + Intergenic
1009731588 6:67614691-67614713 TTGTATTGTAATTTGAAGTCTGG + Intergenic
1009900633 6:69803881-69803903 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1010490828 6:76475030-76475052 TTTTTTTTTGATATGGAGTCTGG + Intergenic
1010598919 6:77799900-77799922 TTGTAGTATGATTTGAAGTCAGG + Intronic
1010612958 6:77978103-77978125 TTGCATTTTTATATAAATTTTGG - Intergenic
1011338951 6:86291336-86291358 GTGCCTTTTGTTTTGAAGTCTGG + Intergenic
1011598714 6:89040560-89040582 TTCTTTTTTGAGATGAAGTCTGG + Intergenic
1011810693 6:91128923-91128945 TTACATTTTGATATGAGATTTGG - Intergenic
1012324556 6:97899903-97899925 TTCAATTTTGATATGAATTTTGG - Intergenic
1012818907 6:104060021-104060043 TTGCATTTTCATGTGAATTTTGG - Intergenic
1013142149 6:107347939-107347961 TGGCATCCTGAGATGAAGTCCGG - Intronic
1013318265 6:108961556-108961578 TTGTATTCTGAAATGAAGTAAGG - Exonic
1014801746 6:125786586-125786608 TTTTTTTTTGAGATGAAGTCCGG + Intronic
1015253391 6:131151052-131151074 TTGTTTTTTGAGATGTAGTCTGG + Intronic
1015881085 6:137870438-137870460 TCTTATTCTGATATGAAGTCCGG + Intronic
1016160234 6:140870508-140870530 TTGCATTATAGTTTGAAGTCAGG - Intergenic
1016506938 6:144792574-144792596 ATGCATTTTGATCTGATATCAGG + Intronic
1019220993 6:170472713-170472735 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1020038679 7:4984417-4984439 TTACATCTTGATATGAGATCTGG - Intronic
1020156623 7:5730058-5730080 TTACATCTTGATATGAGATCTGG + Intronic
1020199141 7:6065637-6065659 TTCCTTTTTGACATGGAGTCTGG + Intergenic
1020229117 7:6303865-6303887 TTTTTTTTTGATATGGAGTCTGG - Intergenic
1020557119 7:9684168-9684190 TTGGAGTTTGATATGATGGCTGG + Intergenic
1020743247 7:12049050-12049072 TTACAATTTGAGATGAAATCTGG + Intergenic
1021506563 7:21391795-21391817 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1021923327 7:25509361-25509383 TTGTATTATAATTTGAAGTCAGG - Intergenic
1022031875 7:26499124-26499146 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1022201729 7:28123657-28123679 TTCCATTTTTAAATGAATTCTGG - Intronic
1022873516 7:34504170-34504192 TTACATTTTGCTATGAGATCTGG + Intergenic
1023425009 7:40026748-40026770 TTTCATTTTAAAATGAAGGCTGG - Intronic
1024258045 7:47553797-47553819 TTTTTTTTTGAGATGAAGTCTGG + Intronic
1024371032 7:48584009-48584031 TTGCATATTTTTATGAAGTTAGG - Intronic
1024597965 7:50955861-50955883 TTACATTTTGATATGAGATTTGG + Intergenic
1024799920 7:53064994-53065016 TTTAATTTTGAGATGGAGTCTGG + Intergenic
1024936361 7:54716033-54716055 TTGCACTTGGATATTAAGCCTGG - Intergenic
1025153458 7:56580537-56580559 TTGCAGTATAATTTGAAGTCAGG + Intergenic
1025763934 7:64423608-64423630 TTGCAGTATAATTTGAAGTCAGG - Intergenic
1026092495 7:67312826-67312848 TTGTATTTTGTTTTGAAGACAGG + Intergenic
1026093005 7:67316911-67316933 TTTATTTTTGAGATGAAGTCTGG + Intergenic
1026327869 7:69326578-69326600 TTTTATTTTGAGATGAAATCTGG + Intergenic
1026728804 7:72893570-72893592 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1027114976 7:75471895-75471917 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1027143044 7:75673365-75673387 TTGCATTTCCATATGAATTTTGG + Intronic
1027180122 7:75933207-75933229 TGGCATATTGTTTTGAAGTCTGG + Intronic
1027291773 7:76721658-76721680 TGGCATAAAGATATGAAGTCTGG - Intergenic
1027494065 7:78865692-78865714 TAGCATTTTGTTATGAAGAATGG + Intronic
1027598133 7:80202100-80202122 TTGTTTTTTGAGATGGAGTCGGG + Intronic
1027856526 7:83518867-83518889 TTTCATTATGCTATGAAGTGGGG - Intronic
1028234236 7:88341300-88341322 ATGCATTTTGATATAGAATCTGG - Intergenic
1028320527 7:89454289-89454311 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1028875813 7:95822506-95822528 CTGTATTTTGAAATGAAGTTAGG + Intronic
1028895803 7:96040220-96040242 TTTAATTTTGAGATGGAGTCTGG - Intronic
1029035475 7:97515807-97515829 CTGCATTTTTATAGGAAGTGGGG + Intergenic
1030221300 7:107101921-107101943 TTGCCTTTTGAGATGAGGACTGG + Intronic
1030456897 7:109785947-109785969 TTGCATATAGATTTGAAGACTGG + Intergenic
1030663040 7:112242904-112242926 TTGCATTATAATTTGAAGTTAGG - Intronic
1031231251 7:119109571-119109593 CTGCATTATAATGTGAAGTCAGG + Intergenic
1031518197 7:122727675-122727697 ATCCATTTTGTTATGAAGACTGG - Intronic
1031585647 7:123530018-123530040 TTTCTTTTTGAGATGGAGTCTGG - Intronic
1032148436 7:129405714-129405736 TTTCATTTTGAAAGAAAGTCTGG - Intronic
1033300415 7:140179666-140179688 TTTTTTTTTGAGATGAAGTCTGG + Intergenic
1033372268 7:140720334-140720356 ATGCATTTTAAAATGAAGGCAGG + Intronic
1033848642 7:145466280-145466302 TTGTAATATAATATGAAGTCAGG + Intergenic
1034105774 7:148488533-148488555 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1034109823 7:148526162-148526184 TTCCTTTTTGAGATGAAGCCTGG - Intergenic
1034511039 7:151534882-151534904 TTACATTTTCATATGAATTTTGG + Intergenic
1035748311 8:1977533-1977555 TTATATTTTGAGATGGAGTCTGG + Intronic
1035821265 8:2594752-2594774 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1038023414 8:23568929-23568951 TTTCCTTTTGAGATGGAGTCTGG - Intronic
1038100959 8:24374741-24374763 TTGCATTTTAACATAAAGTTTGG + Intergenic
1038197896 8:25384919-25384941 TTTTATTTTGAGATGGAGTCTGG - Intronic
1038698834 8:29830580-29830602 TTCTATTTTGATATATAGTCTGG - Intergenic
1039268194 8:35851440-35851462 TTGTAGTATGATTTGAAGTCTGG + Intergenic
1039946990 8:42138659-42138681 TTAGAGTTTGATATGCAGTCTGG - Intergenic
1039973159 8:42337716-42337738 TTGCAGTTCGATATGAACCCAGG + Intergenic
1040587417 8:48756749-48756771 TTGCAGTTTCAGATGAGGTCAGG + Intergenic
1040644735 8:49385004-49385026 TTGGGTATTGATATGAAATCTGG + Intergenic
1040680302 8:49801075-49801097 TTGCATTTCAATATGAAATTTGG - Intergenic
1040771062 8:50976626-50976648 TTGCAGTATGGTTTGAAGTCAGG - Intergenic
1041132634 8:54718220-54718242 TTGCCTTTTCATATAAACTCAGG - Intergenic
1041294989 8:56346747-56346769 TTGTATTTTAATTTGACGTCAGG + Intergenic
1041355722 8:56997265-56997287 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1041966569 8:63685311-63685333 TTGGATCATGATATGAAGTATGG + Intergenic
1042337485 8:67644027-67644049 CTGCATTGTGATATGAAGAGTGG - Intronic
1042398660 8:68320348-68320370 TTGCATTTCCATATGATTTCAGG + Intronic
1042522707 8:69731007-69731029 TTTTTTTTTGAGATGAAGTCTGG + Intronic
1043281177 8:78468642-78468664 TTGTAGTTTGGTTTGAAGTCAGG - Intergenic
1043704830 8:83335268-83335290 TTACAATTTGATATGAATTTGGG - Intergenic
1044222706 8:89688012-89688034 TTGCAGTATCATTTGAAGTCGGG + Intergenic
1044626942 8:94243157-94243179 TTGCAGAGTGCTATGAAGTCAGG - Intergenic
1044671174 8:94682376-94682398 TTGTTTTTTGAGATGTAGTCTGG + Intronic
1045746119 8:105424344-105424366 TTGCATCTAGATATGAAGAATGG + Intronic
1045794612 8:106028030-106028052 TTGTAGTGTGATTTGAAGTCAGG - Intergenic
1046406450 8:113778918-113778940 TTTCTTTTTGAGATGGAGTCTGG - Intergenic
1046435420 8:114181368-114181390 TTTTTTTTTGAGATGAAGTCTGG - Intergenic
1046481161 8:114820909-114820931 TTACATTTTAATATGAAATTTGG + Intergenic
1046560667 8:115833085-115833107 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1047640667 8:126818138-126818160 TTGTTTTTTGATATGGAGTTTGG + Intergenic
1047826031 8:128576570-128576592 TTCCATTCTGATTGGAAGTCTGG - Intergenic
1048038591 8:130702659-130702681 TTGCATTTTGGAAAGAAATCTGG - Intergenic
1051385545 9:16504488-16504510 TTACATTTTAATCTGAATTCAGG - Intronic
1051389321 9:16546884-16546906 TTGAAGTTTGATTTGAATTCAGG - Intronic
1051454675 9:17241461-17241483 TTGTAATATGATTTGAAGTCAGG + Intronic
1051615641 9:19003479-19003501 TTGCAGTTTAGTTTGAAGTCAGG - Intronic
1051866460 9:21688477-21688499 CTGCCTTTTGATATGAGGTGAGG + Intergenic
1052293574 9:26871900-26871922 ATTTATTTTGAGATGAAGTCTGG - Intronic
1052385661 9:27821049-27821071 TTCCATTTTGTTATAAAGTATGG + Intergenic
1052545547 9:29873471-29873493 TTTCATTTTGATAGACAGTCTGG + Intergenic
1053189831 9:36054359-36054381 TAGAATTTAGATAAGAAGTCAGG + Intronic
1053219154 9:36297338-36297360 TTGTTTTTTGATATGGAATCTGG + Intronic
1053341268 9:37336174-37336196 CTACATTTTGCTATGAAATCAGG - Intronic
1054361385 9:64123924-64123946 CTGCATTTAGAAATGAAGTAGGG + Intergenic
1054908787 9:70434516-70434538 TTGCAGTATGTTTTGAAGTCAGG + Intergenic
1055133257 9:72800199-72800221 TGGCTTTTTGAAGTGAAGTCTGG + Intronic
1055181791 9:73397140-73397162 TTGCAGTATAATTTGAAGTCAGG + Intergenic
1056604151 9:88072069-88072091 TTGTAGTATGATTTGAAGTCAGG - Intergenic
1056629250 9:88279226-88279248 TTGCATTTTGATTTATAGTATGG - Intergenic
1057060252 9:91997696-91997718 GTGCATTTAGATATGAAGAATGG - Intergenic
1058104251 9:100952306-100952328 TTGCAGTATAATTTGAAGTCAGG + Intergenic
1058197087 9:101991027-101991049 TTCGTTTTTGATATGAAGTCTGG + Intergenic
1058208123 9:102133517-102133539 TTGCAATATCATTTGAAGTCAGG - Intergenic
1058406379 9:104679962-104679984 CTGTATTATGATTTGAAGTCAGG - Intergenic
1058462088 9:105192197-105192219 TGAAATTTTGATCTGAAGTCAGG - Intergenic
1058911855 9:109527541-109527563 TAGCATTTTGATAGTAAGTAGGG + Intergenic
1059179962 9:112202291-112202313 CTGCATCTTGATATAATGTCTGG - Intergenic
1059479752 9:114579916-114579938 TTCCATTTTGATTTTTAGTCTGG - Intergenic
1059720657 9:116957087-116957109 TTGTATTTTCATATGAATTTTGG - Intronic
1060899593 9:127245558-127245580 TTGCAATTTGGTTTCAAGTCCGG - Intronic
1061970633 9:134043265-134043287 GTCAATTTTGATAGGAAGTCTGG - Intronic
1186895192 X:13998297-13998319 TTGCAATTTGAGATGAAATTCGG - Intergenic
1186976066 X:14906089-14906111 TTGCATTTTCATATGAATTTTGG - Intronic
1187117825 X:16371351-16371373 TTGCTTTTTGAGATGGAGTCTGG + Intergenic
1187263440 X:17708681-17708703 TAGAATTTTGATATGAACACTGG + Intronic
1187568070 X:20472882-20472904 TTGAATTTTAATAGGAATTCAGG - Intergenic
1188278203 X:28227841-28227863 TTGCAGTATAGTATGAAGTCAGG + Intergenic
1188722156 X:33535715-33535737 TTCCAGTTTGATTTGAAGTGTGG + Intergenic
1188773720 X:34187298-34187320 TTGCAGTATAATTTGAAGTCAGG + Intergenic
1188775657 X:34215463-34215485 TTACAATTTGATATGAAATCTGG - Intergenic
1189938200 X:46091852-46091874 TTGCAGTATAATTTGAAGTCAGG - Intergenic
1190017488 X:46839984-46840006 TTTCTTTTTGAGATGGAGTCTGG + Intronic
1190379391 X:49825109-49825131 TTGCATTTCCATATGAATTATGG - Intergenic
1190390738 X:49928911-49928933 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1190467357 X:50738916-50738938 TTGCAGTATGGTTTGAAGTCAGG - Intronic
1190803100 X:53810854-53810876 TTTTATTTTGAGATGGAGTCTGG - Intergenic
1190821080 X:53973384-53973406 TAGCCTTGTGGTATGAAGTCGGG - Intronic
1190993591 X:55580975-55580997 TTGCAGTATAATTTGAAGTCAGG - Intergenic
1191629623 X:63308518-63308540 TTGCAGTATACTATGAAGTCAGG - Intergenic
1192664294 X:73070986-73071008 TTGCAGTATGATTTGAAGTCAGG - Intergenic
1192683054 X:73273218-73273240 TTGCAGTGTAATTTGAAGTCAGG - Intergenic
1192750833 X:73989531-73989553 TTGCAGTGTGATATGAAGAAGGG + Intergenic
1193003052 X:76583992-76584014 TGGCAATTTAATTTGAAGTCCGG + Intergenic
1193141078 X:78027676-78027698 TTGCAGTATAATTTGAAGTCAGG - Intronic
1193898032 X:87138414-87138436 CTGCATTATAATTTGAAGTCAGG - Intergenic
1193933675 X:87588381-87588403 TTGCAGTATAATTTGAAGTCAGG - Intronic
1193994674 X:88350660-88350682 TTGCAGTGTAATTTGAAGTCTGG - Intergenic
1194329417 X:92562319-92562341 TTACATTTTAATATGAGGTGTGG + Intronic
1194583177 X:95701322-95701344 TTGTAGTATGATTTGAAGTCTGG + Intergenic
1194880441 X:99244204-99244226 TTGTATTATAATTTGAAGTCAGG + Intergenic
1195642101 X:107187407-107187429 ATTTATTTTGAGATGAAGTCTGG + Intronic
1196537502 X:116864703-116864725 TTGTATTATGGTTTGAAGTCAGG + Intergenic
1199186941 X:144926248-144926270 TTGCAGTATAGTATGAAGTCAGG - Intergenic
1199460672 X:148081194-148081216 TAGCATTTGGATCTGATGTCAGG + Intergenic
1200330368 X:155290261-155290283 TTCCATGTTGATATAAAGTAGGG - Intronic
1200638116 Y:5681509-5681531 TTACATTTTAATATGAGGTGTGG + Intronic
1200764997 Y:7073052-7073074 TTGCATTTTGTGATGATTTCGGG + Intronic
1200805793 Y:7432390-7432412 TTGTAGTATGATTTGAAGTCAGG - Intergenic
1201748474 Y:17406048-17406070 TTGTTTTTTGAGATGAAGCCTGG + Intergenic
1202045401 Y:20732378-20732400 TTGCATTTTGTGATAATGTCAGG + Intergenic