ID: 1121482242

View in Genome Browser
Species Human (GRCh38)
Location 14:94288159-94288181
Sequence GCTATAAGTTTCCTGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121482242_1121482246 3 Left 1121482242 14:94288159-94288181 CCTGCCTTCAGGAAACTTATAGC 0: 1
1: 0
2: 7
3: 59
4: 386
Right 1121482246 14:94288185-94288207 CTGGAGGAGACATTAAATCACGG 0: 1
1: 0
2: 0
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121482242 Original CRISPR GCTATAAGTTTCCTGAAGGC AGG (reversed) Intronic
900012175 1:124291-124313 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
900042235 1:480281-480303 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
900063675 1:715277-715299 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
900894891 1:5476531-5476553 GCTGCCAGTTCCCTGAAGGCAGG + Intergenic
900977966 1:6028886-6028908 GCTCAAAGGTTCCAGAAGGCTGG - Intronic
902243979 1:15107223-15107245 TCTGTAAGCTTCGTGAAGGCAGG - Intronic
902287350 1:15415181-15415203 GCTATAAGCCTCTTGAGGGCAGG - Intronic
903606904 1:24581496-24581518 CCTGTAAGTTCCCTGCAGGCAGG + Intronic
903803258 1:25985635-25985657 ACTATAATCTTCCTGAAGGTAGG + Intronic
903904595 1:26675238-26675260 GCTATACATTTCAAGAAGGCAGG + Intergenic
904010514 1:27387293-27387315 GCTGTAAGCTTCATGAAGGCAGG + Intergenic
905787271 1:40768331-40768353 CCTATAAGATGCCTGAGGGCAGG - Intronic
906568794 1:46818904-46818926 ACTACAAGCCTCCTGAAGGCAGG - Exonic
906815395 1:48873520-48873542 TGTGTGAGTTTCCTGAAGGCAGG + Intronic
907085346 1:51667588-51667610 GATATAAGTGCCTTGAAGGCAGG + Intronic
907251838 1:53144656-53144678 CTTATAAGCTTCCTGAAGGCAGG - Intergenic
907588949 1:55647330-55647352 ACTATAAGCTTCATGAGGGCAGG + Intergenic
907641957 1:56199627-56199649 GCTATAAGCTTCATGAAGGCAGG + Intergenic
907730991 1:57065502-57065524 TCTATAAGCTTGCTGAGGGCAGG + Intronic
908543860 1:65146609-65146631 GCAACAGATTTCCTGAAGGCAGG + Intergenic
908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG + Intronic
908986590 1:70031150-70031172 ACTGTGAGTTTCATGAAGGCAGG + Intronic
910754290 1:90670356-90670378 ACTATAAGCTGCATGAAGGCAGG + Intergenic
910874587 1:91866519-91866541 GATATAAGCTCCCTGAGGGCAGG - Intronic
911400470 1:97368426-97368448 GCTTTAGGTTTTCTGATGGCAGG + Intronic
911730364 1:101286547-101286569 GGTATAAGCTTCCTGATGGAAGG + Intergenic
912019367 1:105087729-105087751 GCTGTAAGTTTGCTGAGGCCCGG + Intergenic
912491056 1:110063088-110063110 TCTAGAAGCTTCCTGAAGGATGG - Intronic
912824098 1:112889563-112889585 CCTATAAATTGCCTGAGGGCAGG + Intergenic
913175577 1:116270097-116270119 GCTATTATTCTCCTGAAGACAGG + Intergenic
913279725 1:117174382-117174404 ACTATAAGCTTCTTGAGGGCAGG - Intronic
914250989 1:145921163-145921185 TCTATACATTTCTTGAAGGCAGG - Intergenic
914422752 1:147544115-147544137 ACTGTAAGTTCCCTGAGGGCAGG - Intronic
914862161 1:151395902-151395924 GCTAAAAGTTCCATAAAGGCAGG - Intergenic
914945983 1:152066597-152066619 TCTATAAGTTTTTTGAAGGCAGG + Intergenic
916344091 1:163768989-163769011 GCTATAATTTTCCTGATGCTAGG + Intergenic
916496237 1:165350414-165350436 GCTATAAGCCTCCTGAAGGCAGG + Intronic
916562194 1:165942674-165942696 GTTAAAAGTTTCCTGAGGGGAGG - Intergenic
916617606 1:166458763-166458785 GCTGTGAGTTTCCTGAGGCCTGG - Intergenic
916665617 1:166964419-166964441 ACTATAAGGTCCCTGAGGGCAGG + Intronic
916923076 1:169488885-169488907 GGTATCAGTTTCCTGTAGGGTGG - Intergenic
916933319 1:169602237-169602259 AATATAAGCTTCTTGAAGGCAGG - Intronic
917107025 1:171502564-171502586 GTTAAAAGTTCCATGAAGGCAGG + Intronic
917680686 1:177363609-177363631 GCTTTAAGTTCCCTGAAGGTAGG + Intergenic
917752964 1:178070724-178070746 TCAATATATTTCCTGAAGGCAGG + Intergenic
917948957 1:180008707-180008729 ACTATAAGCTCCATGAAGGCAGG - Intronic
918381490 1:183960019-183960041 AATATAAGTTCCCTGATGGCAGG + Intronic
918968996 1:191388263-191388285 GATATCCGTTTCCTTAAGGCTGG - Intergenic
919052381 1:192526734-192526756 AATATAAGTTTCATGAAGTCAGG + Intergenic
919142886 1:193595432-193595454 ACTATAAGTGCCATGAAGGCAGG - Intergenic
920267456 1:204734657-204734679 GATGTAAGGTTCGTGAAGGCAGG + Intergenic
920988452 1:210912870-210912892 GCTCTAAGCTTCCTGAGGGTGGG - Intronic
921165730 1:212505525-212505547 ACTGTAAGTTCCCTGAGGGCAGG - Intergenic
921711349 1:218376749-218376771 GCTATAAGCTACTTGAGGGCAGG - Intronic
922351539 1:224738174-224738196 GCTGTATGCTTCCTCAAGGCAGG + Intronic
923842880 1:237693017-237693039 ACTATAGGCTTCTTGAAGGCCGG - Intronic
924599632 1:245477379-245477401 GATCTAAGCTGCCTGAAGGCAGG - Intronic
1063778082 10:9287503-9287525 ACTGTAAGCTTCTTGAAGGCAGG - Intergenic
1067232282 10:44420179-44420201 GCTGGAGGCTTCCTGAAGGCTGG + Intergenic
1067468256 10:46517381-46517403 GCTTTAGGTTTTCTGAAGCCAGG - Intergenic
1067661991 10:48243176-48243198 ACCATTATTTTCCTGAAGGCAGG - Intronic
1068365159 10:56038481-56038503 GCTCTAGGTTTCCTCAAGGCAGG + Intergenic
1068615012 10:59104437-59104459 GCTCTAAGCTTGGTGAAGGCAGG + Intergenic
1068623984 10:59219779-59219801 GATATAATTTTCCCTAAGGCAGG + Intronic
1068965343 10:62906380-62906402 ACTATAAGTTCCATGAAGTCAGG - Intronic
1068980771 10:63060252-63060274 GCTGTAAGTTTCCTGAGGGAAGG + Intergenic
1069346606 10:67477287-67477309 CCTACAGGTTTCCTGATGGCAGG - Intronic
1069684395 10:70308471-70308493 CCTCTCAGTTCCCTGAAGGCAGG + Intronic
1070050842 10:72888244-72888266 GCTGTAAGCTGCCAGAAGGCAGG - Intergenic
1070183816 10:74040235-74040257 ACTGTAAGTTCCGTGAAGGCAGG + Intronic
1070401579 10:76057464-76057486 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
1070757488 10:79002443-79002465 GCTAAGAGGTTCCTGAAGGGTGG - Intergenic
1072845695 10:98827733-98827755 GCTTTAAGGTTGCTGAAGCCAGG + Intronic
1072936839 10:99721276-99721298 CCCATAAGTTTTGTGAAGGCAGG + Intronic
1073387794 10:103141800-103141822 AATATAAGTTTCATGAGGGCTGG - Intronic
1074090802 10:110252652-110252674 AATATAAGTTTCAGGAAGGCAGG + Intronic
1074119234 10:110481111-110481133 ACCAAATGTTTCCTGAAGGCTGG - Intergenic
1074690473 10:115999674-115999696 TCTGCAAGTTTCCTGGAGGCAGG + Intergenic
1075889599 10:125935272-125935294 ACTATAAGCTTCCTGAAGGCAGG + Intronic
1076121599 10:127940879-127940901 ACTATGACTTTCCTGCAGGCAGG + Intronic
1076968506 11:116497-116519 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
1078521955 11:12070676-12070698 GCTATAAATGTTCTGAAGGTGGG - Intergenic
1079349373 11:19679781-19679803 GGTATGAGCTTCCTGAGGGCAGG + Intronic
1079998126 11:27318078-27318100 TCTTCATGTTTCCTGAAGGCAGG + Intergenic
1080403179 11:31955866-31955888 ACTATAAGCTTCGTGAGGGCGGG - Intronic
1080467562 11:32512089-32512111 GCTGTAAGCTTCCTGAAGAGGGG + Intergenic
1081219319 11:40440125-40440147 ACTATAAGTTACATGAGGGCAGG + Intronic
1081806110 11:45891511-45891533 GCTGCAAGTTTCCTGAGGGCAGG - Intronic
1082770820 11:57206231-57206253 ACCATAAGTTTCTTGAAGTCAGG + Intergenic
1083019386 11:59491237-59491259 ACTATAAGTTTCCTAATGGCTGG + Intergenic
1083129721 11:60613817-60613839 AATATAAGCTCCCTGAAGGCAGG - Intergenic
1084157204 11:67320457-67320479 GCTATGAGTTTCCTGTAGAGAGG + Intronic
1084537870 11:69768490-69768512 GGTATAAGGTTGCTTAAGGCTGG - Intergenic
1085093757 11:73741918-73741940 CCTATATGTCTCCTGGAGGCAGG - Intronic
1085774091 11:79350077-79350099 TCTGGAAGTTTCCTGAGGGCAGG - Intronic
1086416515 11:86594103-86594125 AATGTAAGTTTCATGAAGGCAGG - Intronic
1086516340 11:87617804-87617826 GCTTTAAATCTCCTGAAGACTGG - Intergenic
1086529839 11:87771967-87771989 GCAAGCAGTCTCCTGAAGGCTGG - Intergenic
1087176518 11:95101017-95101039 ATTCTAAGTTCCCTGAAGGCAGG + Intronic
1087656352 11:100928079-100928101 TCTCTAAGTTTCCTCCAGGCAGG + Intronic
1088139390 11:106596931-106596953 ACTGTAAGTTTTGTGAAGGCAGG - Intergenic
1088565568 11:111168783-111168805 ACAACAAGTTTGCTGAAGGCAGG + Intergenic
1088846330 11:113671518-113671540 GATGTAAGTTTCATGAAGGCAGG - Intergenic
1089606143 11:119642500-119642522 GAGAGAAGTTTCCTGGAGGCAGG - Intronic
1091115744 11:133011505-133011527 GCTATAAAACTCCAGAAGGCAGG + Intronic
1096456970 12:51795525-51795547 GTTATAAGGTACCAGAAGGCAGG + Intronic
1097155196 12:57006909-57006931 GCTGTGGGCTTCCTGAAGGCAGG + Intergenic
1097346272 12:58496803-58496825 GCTATAGACTTCCTGAAGGTGGG + Intergenic
1098097508 12:66974420-66974442 AATATAAGCTTCATGAAGGCAGG + Intergenic
1098182435 12:67862261-67862283 GCTTTAAGTGTCATGAAGTCAGG - Intergenic
1098266183 12:68722935-68722957 GGGATAAGTTTCCTGAAAGCAGG + Intronic
1099593669 12:84628804-84628826 GCTAAAAGCTTCATGAAGGCAGG - Intergenic
1100206968 12:92360854-92360876 TCTAGAAGCTCCCTGAAGGCAGG + Intergenic
1100364644 12:93908619-93908641 ACTATAGGATCCCTGAAGGCAGG + Intergenic
1100386674 12:94110323-94110345 ATTATAAGTTGCATGAAGGCAGG + Intergenic
1100555176 12:95686239-95686261 ACTATAAGTTCCCTGAGGGCTGG - Intronic
1100600513 12:96108488-96108510 GCTGAAGGCTTCCTGAAGGCGGG - Intergenic
1100695281 12:97085960-97085982 ACTATAAGTTCCATGAGGGCAGG + Intergenic
1100922714 12:99506928-99506950 ACTATAAGCTCCATGAAGGCTGG + Intronic
1101880991 12:108625584-108625606 ACTATAAGCTTCCTGAGAGCAGG - Intronic
1102387783 12:112524825-112524847 GCCATCAGTTCCCTGAGGGCTGG + Intergenic
1103216038 12:119202193-119202215 GCTCTCAGGTTGCTGAAGGCTGG + Intronic
1104444957 12:128825099-128825121 GGTGTAAGCTTCCTGATGGCAGG + Intergenic
1104794879 12:131510367-131510389 ACTATAGGTTCCCTAAAGGCTGG + Intergenic
1105742674 13:23344337-23344359 GAGATAATTTTCCTGAAGGTAGG - Intronic
1106189359 13:27437727-27437749 TCTATAATTTTCCAGTAGGCAGG - Intronic
1106512627 13:30424427-30424449 ACTGTACATTTCCTGAAGGCAGG + Intergenic
1106565356 13:30880058-30880080 GCCATGAGGTTCCTGATGGCTGG - Intergenic
1106599011 13:31171513-31171535 TCTTTCAGTTTCCTGAAGGCAGG - Intergenic
1106719827 13:32426793-32426815 TCTGTAAGTTTCTTGAAGGTAGG - Intronic
1106744929 13:32691901-32691923 TCTTTAATTTTCCTGAATGCAGG + Intronic
1107895120 13:44954391-44954413 ACTATGAGTTTCTGGAAGGCAGG + Intronic
1108088589 13:46821959-46821981 GCTATGGGCTTCCTGAGGGCAGG + Intergenic
1108972731 13:56397600-56397622 GCTATAATTTGCCTAAGGGCAGG + Intergenic
1109220100 13:59633037-59633059 GCTATAAGTTCTGTGAGGGCAGG - Intergenic
1110528970 13:76574484-76574506 TCTACAAGCTTCCTGAAGGCAGG + Intergenic
1111826811 13:93277751-93277773 ACTATAAGTTTTCTAAGGGCAGG + Intronic
1112408901 13:99145365-99145387 GTTATAAGCCTCTTGAAGGCAGG + Intergenic
1114619645 14:24087736-24087758 TCTGTAAGTTTCTTGAAGTCAGG - Intronic
1115348598 14:32368836-32368858 ACTATAAGTTTCAAGAGGGCAGG - Intronic
1115510771 14:34136016-34136038 ACTATAATTTTGCTGAAGGAAGG + Intronic
1116777036 14:49193262-49193284 GCTATAAGCTCCATGAGGGCAGG + Intergenic
1116795225 14:49383084-49383106 TCTGTAAGTTTCCTGAGGGCAGG - Intergenic
1117096537 14:52304276-52304298 GATATAAGTCTCCAGAGGGCAGG - Intergenic
1117352394 14:54893962-54893984 GCTGTAAGTTCCATGAAGGCAGG + Intronic
1117487460 14:56212758-56212780 CCTACAAGTATCCTGGAGGCTGG + Intronic
1117726713 14:58681901-58681923 GTTATAAGTGTCTTGAGGGCAGG - Intergenic
1118439179 14:65797699-65797721 ACTCTAAGTTCCCTGAAGGCAGG - Intergenic
1119567970 14:75645112-75645134 GCTGTTAGTTTCCTGAATGATGG + Intronic
1121482242 14:94288159-94288181 GCTATAAGTTTCCTGAAGGCAGG - Intronic
1122244927 14:100395676-100395698 GATATAAGTTCCATGAGGGCAGG + Intronic
1125036195 15:35127075-35127097 GCTTGAAGTTTCTTGAGGGCAGG - Intergenic
1126331997 15:47543049-47543071 ACTGTAAGTATCCTGAGGGCAGG + Intronic
1127010560 15:54621892-54621914 ACTATGAGTTTCATGAAGGCAGG + Intronic
1127373364 15:58360402-58360424 GATCTAAGTTTCATGAAGACAGG - Intronic
1128040899 15:64572508-64572530 GATATAAGCTTCCTGAGGACAGG + Intronic
1128114279 15:65095544-65095566 GCTGTGAGTTCCTTGAAGGCAGG - Intronic
1128396659 15:67233080-67233102 AGAATGAGTTTCCTGAAGGCAGG + Intronic
1128851128 15:70957623-70957645 ACTGTAAGTTTCTTGAAGACTGG - Intronic
1130264052 15:82382676-82382698 GCTGTAATTCTTCTGAAGGCTGG - Intergenic
1130276969 15:82484929-82484951 GCTGTAATTATTCTGAAGGCTGG + Intergenic
1130469333 15:84212290-84212312 GCTGTAATTCTTCTGAAGGCTGG + Intergenic
1130476823 15:84326834-84326856 GCTGTAATTCTTCTGAAGGCTGG + Intergenic
1130494942 15:84461296-84461318 GCTGTAATTCTTCTGAAGGCTGG - Intergenic
1130508359 15:84568392-84568414 GTTGTAATTTTTCTGAAGGCTGG + Intergenic
1130591627 15:85216909-85216931 GCTGTAATTCTTCTGAAGGCTGG + Intergenic
1130772677 15:86940515-86940537 CTTATAAGTTCCCTGAAGGTAGG - Intronic
1131456958 15:92589081-92589103 ACTATTAGTTTCCTGAGGACAGG - Intergenic
1131473902 15:92719802-92719824 GATGTAAGTTCCATGAAGGCAGG - Intronic
1131676669 15:94677117-94677139 GATGTAAGTTTCCAGAGGGCAGG + Intergenic
1132236826 15:100228363-100228385 ACTGTAAGTGTTCTGAAGGCAGG + Intronic
1133153919 16:3858505-3858527 GCTGTAAGCTCCCTGAAAGCAGG + Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1135067339 16:19321607-19321629 GCTGTGAGTTTCCTGAGGTCTGG + Intronic
1135642420 16:24132491-24132513 AATATAAGTTTCATGAGGGCAGG - Intronic
1136995982 16:35188278-35188300 GCCATAAGGTACATGAAGGCAGG - Intergenic
1137814700 16:51387481-51387503 AATATAAGGTCCCTGAAGGCAGG - Intergenic
1138108749 16:54306511-54306533 ACTGTAAGTTCCCTAAAGGCAGG + Intergenic
1138310152 16:56016691-56016713 GCTACAAGGTTCCTGTGGGCTGG - Intergenic
1139359740 16:66390109-66390131 GGCATAAGCTCCCTGAAGGCAGG + Intronic
1140089546 16:71826347-71826369 ACTATAAGCTTCATGAGGGCAGG - Intergenic
1140680219 16:77377369-77377391 TAAATAAGCTTCCTGAAGGCAGG + Intronic
1140737037 16:77907649-77907671 GCTATAAGCTTTCTAAAAGCAGG + Intronic
1141442605 16:84039355-84039377 GCTCTAAGCTCCCTGAAGACTGG + Intronic
1141778434 16:86140297-86140319 GCTATATGTTTCCCTGAGGCTGG + Intergenic
1142452171 16:90182623-90182645 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1143502979 17:7349669-7349691 GTTAAAAGTCTCCTGTAGGCCGG - Intronic
1143783982 17:9243440-9243462 TCTTTCACTTTCCTGAAGGCAGG - Exonic
1144821695 17:18079260-18079282 GCTCTGAGCTTCCTGAGGGCAGG + Intergenic
1146027737 17:29337188-29337210 TCTGTAAGTTTCTTGATGGCAGG + Intergenic
1146951808 17:36912024-36912046 GCTGTGAGTTTCCCGAAGACAGG - Intergenic
1147010085 17:37438938-37438960 ACTATAAGCTTTCTGAAGACAGG - Intronic
1148472214 17:47901934-47901956 GATGTAAGCTTCCTAAAGGCAGG - Intronic
1149302474 17:55318037-55318059 ACTACAAGTTCCATGAAGGCAGG - Intronic
1150123025 17:62619030-62619052 GCTGTAAGCTTCCTTAAGGCAGG - Intergenic
1150638233 17:66931629-66931651 ACTGTAAGTTTCCTGAAGGTAGG - Intergenic
1150779331 17:68107430-68107452 GCTTTAAGTTCCATGAAGTCAGG + Intergenic
1152823864 17:82451255-82451277 GCTGTAAATTTCATAAAGGCAGG - Intergenic
1152930879 17:83109318-83109340 CATGTAATTTTCCTGAAGGCTGG - Intergenic
1153565779 18:6415449-6415471 GCCATAAGTTCCATGAGGGCAGG - Intergenic
1153580347 18:6567063-6567085 GCTAAAAGTTTCCTGAATGGTGG + Intronic
1153744711 18:8165779-8165801 ACTATAAGCTTCCAGAATGCTGG - Intronic
1154054653 18:11001185-11001207 GATGTAAGCCTCCTGAAGGCAGG + Intronic
1156110294 18:33718181-33718203 ACTATAATCTCCCTGAAGGCAGG - Intronic
1156801467 18:41119892-41119914 ACTCTAAATTTCCTGAGGGCTGG + Intergenic
1156882565 18:42098482-42098504 ACTGTAAGTTCCCTGAAGGCAGG + Intergenic
1159047354 18:63382085-63382107 ACTGTAAGTTTCTTGAGGGCAGG + Intergenic
1159791796 18:72790889-72790911 ACTATTAATTTCATGAAGGCTGG - Intronic
1160645315 19:186422-186444 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
1164793598 19:31008369-31008391 GCAGTAAGTTCCCTGAAGGCAGG - Intergenic
1165923436 19:39312902-39312924 GCTATAAGCTCCCTGAGGACAGG + Intronic
1165936104 19:39390017-39390039 GGTATGAGTTCCTTGAAGGCAGG - Intronic
1166116874 19:40661742-40661764 ACTCTGAGTTCCCTGAAGGCAGG + Intergenic
1166984481 19:46651415-46651437 GCTGGCAGTTTCCTGAGGGCAGG + Intronic
925931168 2:8709306-8709328 GCTGTCAGCTTCCTGAACGCAGG + Intergenic
926463238 2:13159558-13159580 ATTATAAGTTCCCTCAAGGCAGG + Intergenic
926604777 2:14886500-14886522 GCTATGCATTTCCTGAAGGCAGG + Intergenic
927555916 2:24031993-24032015 GCTGTAAGTTCCCTAAGGGCAGG + Intronic
928079702 2:28299661-28299683 GCTATAAATTCCATGAAGACAGG - Intronic
929015281 2:37487449-37487471 AATATAAGTTCCCTGAGGGCAGG + Intergenic
929723975 2:44404084-44404106 ACTGTAAGCTTCCAGAAGGCAGG + Intronic
929892652 2:45931325-45931347 ACTATAAGCTCCCTGAAAGCAGG - Intronic
929905248 2:46040084-46040106 GCTGGAAGTTTCCTGAAGGCAGG + Intronic
930300357 2:49608165-49608187 GCTATAAAATTTCTGAAGGAAGG + Intergenic
930582094 2:53224074-53224096 TCTGTGAGTTACCTGAAGGCAGG + Intergenic
930641019 2:53854527-53854549 GTTCTGAATTTCCTGAAGGCTGG + Exonic
930798052 2:55413642-55413664 GCTGTGAGTTTCCTGAAGCCAGG - Intronic
931020095 2:58034532-58034554 GCTCTAAGTTTTAAGAAGGCAGG + Intronic
931519560 2:63080788-63080810 CCTGTAAGTTCCGTGAAGGCAGG + Intergenic
931682357 2:64761526-64761548 GCTATAAATTCCTTGAAGGCAGG - Intergenic
931915202 2:66947012-66947034 GCTATATGTTCCTTGAGGGCAGG - Intergenic
932260864 2:70325946-70325968 GCAATAAGCATCATGAAGGCAGG + Intergenic
933527928 2:83467373-83467395 ACTCTAAACTTCCTGAAGGCAGG - Intergenic
935067663 2:99664803-99664825 ACTGGAAGTTTCCTGAGGGCAGG - Intronic
936457533 2:112686764-112686786 GCTATGAGCTTCGTGTAGGCAGG + Intergenic
937636692 2:124164209-124164231 ACTGTAAGTTCCATGAAGGCAGG - Intronic
937815044 2:126241960-126241982 GCTATAATTTTGCTCAGGGCTGG + Intergenic
938860411 2:135362356-135362378 GCTATCACTTTCCTGATGGTTGG + Intronic
938979525 2:136513151-136513173 GAAATAAGTATCCTCAAGGCTGG + Intergenic
940022854 2:149173893-149173915 ACTATAAGGTTTCTGAAAGCAGG - Intronic
941649985 2:168082169-168082191 GCTATAAGTGTCTTGAAGGAAGG - Intronic
942143127 2:172998087-172998109 ATTATAAGCTTCCTGAAGGCAGG - Intronic
942544676 2:177051056-177051078 ACTATAAGCTCCATGAAGGCAGG - Intergenic
942794126 2:179796112-179796134 GCTATAAATTTCCTCAAGATTGG - Intronic
943931286 2:193856951-193856973 GCTGTAAGTTTCTTGAAGACAGG + Intergenic
945159543 2:206875097-206875119 ACTATAAGCATCCTGAGGGCAGG - Intergenic
945901265 2:215540160-215540182 ACTATAAGCTCCATGAAGGCAGG + Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
947779152 2:232741885-232741907 CCTCTTAGTTTCATGAAGGCTGG + Intronic
948193677 2:236079166-236079188 GCTGTGAGTTTCCTGAGGGCAGG - Intronic
948267568 2:236646772-236646794 GCTCTGAGTTTCCTGAAAGCTGG - Intergenic
949083613 2:242127266-242127288 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1169998009 20:11580979-11581001 ACTATAAGTATCCTGAAGGCAGG - Intergenic
1170327416 20:15171848-15171870 ACTCTAAGTTCCCTGAAGACTGG + Intronic
1170534597 20:17327419-17327441 ACTGTAAGTCTCGTGAAGGCAGG + Intronic
1170543108 20:17408621-17408643 GCTATAAGTTACATAAGGGCAGG + Intronic
1172617129 20:36296655-36296677 GATGTAAGCTTCATGAAGGCAGG + Intergenic
1173340962 20:42152578-42152600 GCTATAGACTTCTTGAAGGCAGG - Intronic
1173476942 20:43366171-43366193 GCTATAAATTCCATGAGGGCAGG + Intergenic
1173691117 20:44961910-44961932 ACTATAAGCTTTCTGAGGGCTGG + Intergenic
1174251907 20:49226206-49226228 ACTGTAAGATTCCTGAGGGCAGG + Intronic
1174829449 20:53799220-53799242 AATATAAGTGGCCTGAAGGCTGG + Intergenic
1177756797 21:25358188-25358210 ACTATAAGGTCCATGAAGGCAGG + Intergenic
1177802122 21:25838369-25838391 GCAATAAGATTCCTGAGGACTGG - Intergenic
1179119889 21:38533873-38533895 ACTATATATTTTCTGAAGGCAGG - Intronic
1179541090 21:42083656-42083678 AATATAAGTTCCCTGAAGGCTGG + Intronic
1181961364 22:26624196-26624218 GATAGAAGTTTCTAGAAGGCAGG + Intronic
1182081258 22:27530405-27530427 CATAGAAGTTTCCTGAGGGCAGG + Intergenic
1182937628 22:34240763-34240785 ACTATGAGTTTCCTGAGAGCGGG - Intergenic
1182942630 22:34292227-34292249 GGTATAAGCTTCCTGAGAGCAGG + Intergenic
1184007826 22:41723659-41723681 ACTATAAGTTTCATGAGGGCAGG - Intronic
1184184304 22:42854161-42854183 ACTATAAGTTCCCTGAGGACAGG + Intronic
949182512 3:1151195-1151217 GCTTTAAGCTTCCAGATGGCAGG + Intronic
949780275 3:7678981-7679003 GCCTTAAGTTCCATGAAGGCAGG - Intronic
949945194 3:9184601-9184623 GCTATAAATACCTTGAAGGCAGG - Intronic
950221169 3:11197326-11197348 GCTGTGAGCTTCCTGAGGGCTGG + Intronic
950305940 3:11915416-11915438 ACTATGAGTTTCCAGAAGGCTGG + Intergenic
950717551 3:14860326-14860348 TCTTTCACTTTCCTGAAGGCAGG + Intronic
950735875 3:15007570-15007592 ACTAAAAGTTTCATGAGGGCAGG + Intronic
952277964 3:31895757-31895779 TCTGTACGTTTCTTGAAGGCAGG - Intronic
952870493 3:37896149-37896171 GCTGCAAGTTTCCAGAAGGCAGG - Intronic
954033825 3:47839588-47839610 AATATAAGAATCCTGAAGGCTGG - Intronic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
955188773 3:56740615-56740637 GTTTTAAGCTTCTTGAAGGCAGG - Intronic
955999911 3:64718247-64718269 ACTATAAGTTCCTTAAAGGCAGG + Intergenic
957579355 3:82050761-82050783 GCCATAAGTTCCATGAGGGCAGG - Intergenic
958668832 3:97176471-97176493 GATATTAGTTTCCTTAAGACTGG + Intronic
958912975 3:100015726-100015748 GCTGTAAGTTCCTTGAAGTCAGG + Intronic
959416158 3:106078316-106078338 ACTATGAGTTTCCTGAGGACAGG + Intergenic
959882265 3:111457439-111457461 GCTGTAAGTTTTATGAAGGTTGG - Intronic
961016233 3:123470319-123470341 GCTATAAGCTACTTGAGGGCAGG - Intergenic
962716258 3:138128682-138128704 TCTACAAGTTTCCTGATGCCTGG - Intronic
962848993 3:139293925-139293947 ACTATAAGCTCCCTGAAGGCAGG - Intronic
963122990 3:141792065-141792087 ACTGTAAGCTTCATGAAGGCAGG - Intronic
963138750 3:141930851-141930873 TCTGTAAGTTCCATGAAGGCAGG - Intergenic
965406623 3:168276966-168276988 GATGTAAGCTTCATGAAGGCAGG + Intergenic
966454356 3:180098424-180098446 GCTATAATTTCCTTGAGGGCAGG + Intergenic
967371580 3:188752625-188752647 GCTATTAGTTTCATCAAGGTTGG + Intronic
968372368 3:198233104-198233126 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
969199431 4:5590844-5590866 ACTATAAGTTTCCTGAGGGCTGG - Intronic
969237559 4:5876746-5876768 GCTATCAGTTTTCAGAAGGGGGG - Intronic
969407135 4:7001006-7001028 ACTCTAAGCTTCCTGAGGGCAGG + Intronic
970171693 4:13296940-13296962 GCTTTAAGTTTACTTCAGGCAGG + Intergenic
970597943 4:17616972-17616994 ATTACAAGCTTCCTGAAGGCAGG - Intronic
970792546 4:19875788-19875810 GCTATCAGCATCCTGAGGGCAGG - Intergenic
970879982 4:20917489-20917511 GCCATAAGCTTCCTGAGGGCAGG - Intronic
971069334 4:23073156-23073178 CCTGTAAGTTTCCTGTAGGGTGG - Intergenic
971128599 4:23781075-23781097 ATTAGAAGTTTCTTGAAGGCAGG + Intronic
971567323 4:28161758-28161780 GCTCTAAGGTTCTTGAGGGCAGG + Intergenic
971747434 4:30601796-30601818 TCTGTAATTTTCCTGAAGGCAGG - Intergenic
972319116 4:37956389-37956411 GATGTAAGTTTCCCGAGGGCAGG + Intronic
972476649 4:39456888-39456910 GCCTTAAGTTCCTTGAAGGCAGG - Intronic
974011778 4:56613644-56613666 GTTTTAAGTTTCCTGAAGCCAGG - Intergenic
974058658 4:57010097-57010119 GACATTAGTTTCATGAAGGCAGG - Intronic
974466630 4:62265460-62265482 GTTATAATTTTCTTGAGGGCAGG - Intergenic
975532519 4:75415466-75415488 ATTATAAATTTCCTGAAGGCTGG - Intergenic
976323062 4:83737762-83737784 GCTGTAAGTTTCTAGAAGTCTGG + Intergenic
977254897 4:94729548-94729570 GCTATAAGCTCCCTGATGTCAGG - Intergenic
978649028 4:110978158-110978180 CCTATAAGCTTTCTGAAGGCAGG + Intergenic
979397442 4:120205523-120205545 AATGTAAGTTTCCTGAGGGCAGG - Intergenic
979789137 4:124756023-124756045 AATATACGTTTCATGAAGGCTGG + Intergenic
980211629 4:129795736-129795758 GCTATAAATTTCTTGAGGGCAGG - Intergenic
981007988 4:139895314-139895336 AATATAAGTTACATGAAGGCAGG + Intronic
981496947 4:145404470-145404492 ACTATAAGTTTCATGAAGGCAGG + Intergenic
982093716 4:151901186-151901208 ACTATAAGCTCCTTGAAGGCAGG - Intergenic
982343065 4:154324751-154324773 GCTATGAGTTTCTTGAAGACAGG - Intronic
982495721 4:156089349-156089371 GCTGTGAGTTTACTGAAGACAGG + Intergenic
983494733 4:168429899-168429921 ATTATAAGTTCCCTGAAGGCTGG + Intronic
984376288 4:178934862-178934884 TTTATAAGTTTCCCAAAGGCTGG + Intergenic
986403286 5:7399848-7399870 GCTCTAAGTTTTCTGATGCCAGG - Intronic
987040731 5:14059854-14059876 AATATAAGCTTCCTGAGGGCAGG - Intergenic
988574467 5:32407262-32407284 ACTATAAGGTTCTTCAAGGCAGG - Intronic
988854730 5:35216883-35216905 GCTGTAAGCTACCTGAGGGCAGG - Intronic
989446607 5:41537064-41537086 GCTATAAATTTCCTGACTGAGGG + Intergenic
991374425 5:65951297-65951319 GAAATAAGTTTCATGAGGGCAGG + Intronic
991449662 5:66738519-66738541 AACATAAGTTTCATGAAGGCAGG - Intronic
991660867 5:68949587-68949609 GCTGCAAGCTTCCTGAAGGACGG + Intergenic
992664582 5:78994627-78994649 TCTATAAACTTCATGAAGGCAGG + Intergenic
993483528 5:88453503-88453525 GCTTTAAGCTACATGAAGGCAGG - Intergenic
994059203 5:95455534-95455556 ACTATAAATTCCCTGAAGGCAGG - Intergenic
994432496 5:99685425-99685447 GCTAAAAGTTTCCCCAAGCCAGG - Intergenic
994534581 5:101012116-101012138 AATATAAGCTTACTGAAGGCAGG - Intergenic
997604952 5:135168189-135168211 GATATAAGCTCCATGAAGGCAGG - Intronic
998076460 5:139240632-139240654 GCTATCAGCTCCCTGAGGGCAGG - Intronic
998232989 5:140373377-140373399 GATTTAAGTTTCCTGAGGTCAGG - Intronic
998595144 5:143521603-143521625 GCTATGAGTTCCATGAAGCCAGG + Intergenic
998888800 5:146723972-146723994 ACTGTAAGTTCCTTGAAGGCAGG + Intronic
998910908 5:146959349-146959371 ACTGTAAGCTTTCTGAAGGCAGG - Intronic
999707749 5:154289488-154289510 ACTGTAAGCTTCTTGAAGGCAGG - Intronic
1000770271 5:165344299-165344321 AATATAAGTTTCCTGAAGGTAGG + Intergenic
1002731608 5:181338648-181338670 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1003618187 6:7673886-7673908 ACTATAAGGTTCTTGAGGGCAGG - Intergenic
1004133616 6:12945370-12945392 ACTGTAAGTTTCATGAAAGCAGG + Intronic
1004172637 6:13308801-13308823 GCTGTAAGCTCCTTGAAGGCAGG - Intronic
1006669683 6:35722215-35722237 GATATAAGTTTCTTGAAAGCTGG + Intronic
1006916419 6:37596847-37596869 ACTAGAAGCTCCCTGAAGGCAGG + Intergenic
1006917098 6:37601775-37601797 ACTAGAAGCTCCCTGAAGGCAGG + Intergenic
1007149173 6:39671075-39671097 ACTATAAGCTTCTTGAAGTCAGG - Intronic
1007648928 6:43404926-43404948 GCTATAAGTTCCATGAGAGCAGG - Intergenic
1008493693 6:52111633-52111655 ACTGTAAGCTTCCTGAGGGCAGG - Intergenic
1010287999 6:74101783-74101805 ACTGTAAGTTTCATGAGGGCAGG - Intergenic
1011000416 6:82582376-82582398 CCTATAATTTTCCACAAGGCAGG + Intergenic
1012016605 6:93860546-93860568 GGTATAAGATCCCTGAAGGAAGG + Intergenic
1012417668 6:99027105-99027127 GCTGTGAGCTTCTTGAAGGCAGG - Intergenic
1012884244 6:104826313-104826335 ACTATAAACTTCTTGAAGGCAGG - Intronic
1013228660 6:108140881-108140903 ACTATAAGTTTCATGAAGACAGG + Intronic
1013388942 6:109663815-109663837 GGTGGAAGTTTCCTGAAGGTTGG - Intronic
1013817821 6:114119839-114119861 ACTGTAAATTTCCTGAGGGCAGG - Intronic
1014467519 6:121774582-121774604 ACTATACATTTCTTGAAGGCAGG + Intergenic
1015090901 6:129357141-129357163 TTTTTAAGTTTCTTGAAGGCAGG - Intronic
1015187811 6:130438266-130438288 GTTATAATTTCACTGAAGGCTGG + Exonic
1015555825 6:134460261-134460283 AATATAAGCTTCATGAAGGCAGG + Intergenic
1015579282 6:134705732-134705754 ACTATAAGCTCCATGAAGGCAGG + Intergenic
1016070682 6:139735223-139735245 GCTATAAGTCTATTGAGGGCAGG - Intergenic
1016440729 6:144080765-144080787 AATATAACTTTCATGAAGGCAGG + Intergenic
1016801758 6:148175928-148175950 GCTGTAAGCTTCCAGAAGGCAGG - Intergenic
1017588374 6:155951655-155951677 GTTATAAATTCCCTGAGGGCAGG - Intergenic
1017905525 6:158755383-158755405 GCTAAAAGTTACCCAAAGGCAGG + Intronic
1018205036 6:161429316-161429338 ACTATAAGCTCCCTGAGGGCAGG - Intronic
1021359664 7:19695570-19695592 CAAATAAGTTTCCTGAGGGCTGG - Exonic
1021421428 7:20449436-20449458 ACTGTTAGTTTCATGAAGGCAGG - Intergenic
1021821877 7:24506548-24506570 ACTATAAGCTTCTTGAAGGCAGG - Intergenic
1022006150 7:26267294-26267316 ACTATGGGCTTCCTGAAGGCAGG - Intergenic
1022748252 7:33195132-33195154 TCTATAAGCTTCCTGAGGGCAGG + Intronic
1022805105 7:33813856-33813878 GCCATGAGTTTACTAAAGGCTGG + Intergenic
1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG + Intronic
1027196151 7:76031898-76031920 ACTATAACCTTCATGAAGGCAGG - Intronic
1028978448 7:96940186-96940208 ACTATAAGTTTCCTAAAGAGGGG - Intergenic
1029341481 7:99948322-99948344 TATATGAGTTTCCTGAGGGCAGG + Intergenic
1030146873 7:106365897-106365919 GGTCTAAATTTCCTGAAGGAAGG + Intergenic
1030773676 7:113506893-113506915 ATTATAAGTTCCATGAAGGCAGG - Intergenic
1031693923 7:124825738-124825760 GTTATAAGTTTCAAGAAGGAAGG + Intronic
1034943658 7:155248313-155248335 GCGAGAAGCTGCCTGAAGGCAGG - Intergenic
1035149729 7:156859880-156859902 CCTATAAGTCTCCTGAAGTCAGG - Intronic
1035511907 8:195631-195653 ACTGTAAGTCTCCTGAAAGCAGG + Intronic
1036489232 8:9209469-9209491 ACTATAAGTTTCCCAAAGGTGGG + Intergenic
1036695955 8:10975281-10975303 GCTCGAAGCCTCCTGAAGGCTGG - Intronic
1037478166 8:19277964-19277986 GCTATAAGCTTCAAGAAGGCAGG + Intergenic
1037487133 8:19358311-19358333 AATATAAGCTCCCTGAAGGCAGG - Intronic
1038054531 8:23845946-23845968 ACTGTAAGCTTACTGAAGGCAGG + Intronic
1038697728 8:29820952-29820974 GCTATAAGCTCCCTGAGGGCTGG + Intergenic
1038753595 8:30319480-30319502 CATGTAAGTTTCTTGAAGGCTGG - Intergenic
1039411463 8:37358585-37358607 ACTCTAAGTACCCTGAAGGCAGG + Intergenic
1039484893 8:37902730-37902752 GCTCAAAGTTCTCTGAAGGCTGG - Intergenic
1039731846 8:40288103-40288125 GGTATAAGTTTCTTGAAAGTTGG + Intergenic
1040461550 8:47653775-47653797 CCTGGAAGTTTCTTGAAGGCAGG - Intronic
1040536619 8:48316417-48316439 GTTGTAGGGTTCCTGAAGGCAGG - Intergenic
1043057554 8:75458590-75458612 CCCCTAAGTTTCTTGAAGGCAGG + Intronic
1043660264 8:82731233-82731255 GCTATAATTTCCATGGAGGCAGG + Intergenic
1044373631 8:91444188-91444210 GATATAAGCTTCTTGAGGGCAGG + Intergenic
1045295833 8:100871136-100871158 CGTGTAAGCTTCCTGAAGGCAGG - Intergenic
1045818480 8:106306167-106306189 GGAATAATTTTCCTGATGGCTGG + Intronic
1045913868 8:107443169-107443191 GCCATAAGATTTCTGAGGGCAGG + Intronic
1047064616 8:121266889-121266911 GCTATATGTTTCCTAATAGCTGG - Intergenic
1047204214 8:122790450-122790472 ACTATGACCTTCCTGAAGGCAGG - Intronic
1047407871 8:124600484-124600506 TCTGTGAGCTTCCTGAAGGCAGG + Intronic
1047464470 8:125099212-125099234 GCTTTATCTTTCCTCAAGGCAGG - Intronic
1047912127 8:129541722-129541744 TCTATAAATTTTCTGAAGACTGG - Intergenic
1048101214 8:131353484-131353506 TGTATAAGTTTCATGAAGGCAGG + Intergenic
1048526537 8:135208134-135208156 GCTGTAAGCTCCATGAAGGCAGG + Intergenic
1048611987 8:136033141-136033163 ACTATAAATTTCATGAAAGCAGG - Intergenic
1049888932 9:49034-49056 ACTGTAAGTCTCCTGAAAGCAGG + Intergenic
1050159201 9:2699464-2699486 CATATAAGATTCCGGAAGGCAGG - Intergenic
1050179478 9:2904646-2904668 GATATGAGTTTCCTGGAGGCAGG + Intergenic
1050217653 9:3345812-3345834 CCTATAAGTTCCATGGAGGCAGG - Intronic
1050384150 9:5067735-5067757 TAGATAAGTTTCCTGAAGGTAGG - Intronic
1051374626 9:16390500-16390522 ACCATAAGTTGCCTGAAGTCTGG - Intergenic
1053272813 9:36761860-36761882 GGAATGAGTGTCCTGAAGGCAGG + Intergenic
1055071201 9:72167965-72167987 GCTATAAGCTCCCTGAGAGCAGG + Intronic
1055152854 9:73024067-73024089 GCTGTAAGTTTCATGAGGGTAGG + Intronic
1055754342 9:79541934-79541956 GCTATAAATTTCCTAAAGCTTGG + Intergenic
1055816267 9:80210319-80210341 GGTATAATTTTTCTGAAGGTGGG - Intergenic
1056006096 9:82272821-82272843 GTTATAAGTAACTTGAAGGCAGG - Intergenic
1057423754 9:94932097-94932119 GCTCTCAGTTCCCTGAAGACAGG - Intronic
1057828719 9:98391175-98391197 TGTGTAAGTTCCCTGAAGGCAGG - Intronic
1059347651 9:113640727-113640749 GCTGCAAGTTTCTTGAAAGCAGG + Intergenic
1059663563 9:116425084-116425106 GCAATAAGTTCCCTGAGGGAAGG + Intergenic
1061067178 9:128285776-128285798 GCTGTAAGCTTCATGAGGGCAGG + Intronic
1062756014 9:138291158-138291180 ACTGTAAGTCTCCTGAAAGCAGG - Intergenic
1186068226 X:5789495-5789517 ACTGTAAGTTCCCTGAGGGCTGG - Intergenic
1186237693 X:7531412-7531434 TCTATAAGCTTCCAGAGGGCAGG - Intergenic
1186556033 X:10559770-10559792 ACTATAAGCTCCATGAAGGCAGG + Intronic
1187590356 X:20711040-20711062 GGTGTAAGCTCCCTGAAGGCAGG + Intergenic
1187878676 X:23826102-23826124 GCTATAATCTTCCTGAGGCCAGG - Intergenic
1189780927 X:44513814-44513836 GTTATAAATTTTGTGAAGGCCGG + Intergenic
1191027144 X:55925817-55925839 ACTATAAGTTCCATGAAGACAGG + Intergenic
1191858519 X:65647078-65647100 ACCATAAGTTTCATTAAGGCAGG - Intronic
1191880585 X:65840803-65840825 GTTATAAGCTTCCTGAGAGCAGG + Intergenic
1194136146 X:90145202-90145224 GTCATAAGTTATCTGAAGGCAGG - Intergenic
1195775118 X:108394591-108394613 GCTGTTAGTTCCTTGAAGGCAGG + Intronic
1198486683 X:137094374-137094396 ACTATAAGCTACGTGAAGGCAGG + Intergenic
1199757283 X:150876644-150876666 AATATAAGTTTCATAAAGGCAGG - Intronic
1200481903 Y:3715266-3715288 GTCATAAGTTATCTGAAGGCAGG - Intergenic