ID: 1121482423

View in Genome Browser
Species Human (GRCh38)
Location 14:94289418-94289440
Sequence GCTATGTGCCAAGCCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121482421_1121482423 29 Left 1121482421 14:94289366-94289388 CCTGCTGATTGGCAGTTTGGAAG 0: 1
1: 1
2: 2
3: 31
4: 117
Right 1121482423 14:94289418-94289440 GCTATGTGCCAAGCCCATCTGGG 0: 1
1: 0
2: 2
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121482423 Original CRISPR GCTATGTGCCAAGCCCATCT GGG Intronic
901493198 1:9607077-9607099 CCTATGATCCAGGCCCATCTGGG + Intronic
901953538 1:12768482-12768504 GCTATGTGGCCAGCTCATCCTGG - Intergenic
902394838 1:16126906-16126928 ACTATGTGCCAGGCCTATCCTGG - Intronic
903885559 1:26539122-26539144 GCTCTGTGCTAGGCCCATGTTGG + Intronic
904289522 1:29475258-29475280 GCCAGGTGCCAGGCCCACCTGGG - Intergenic
905015420 1:34775020-34775042 GGTATGTGCCAAGACTTTCTGGG - Intronic
907457004 1:54582377-54582399 CCTGTGTGCCAGGCCCCTCTAGG + Intronic
909525936 1:76622561-76622583 CCTCTGTTCCAAGCTCATCTGGG - Intronic
915744453 1:158145360-158145382 GCTGAATGCCAAGGCCATCTGGG - Intergenic
918352722 1:183674188-183674210 GCTATTTGCTCAGACCATCTTGG - Intronic
921407723 1:214799358-214799380 GCTTTGCCCCAAGCCCATTTTGG - Intergenic
923447603 1:234087164-234087186 GGTGTGTGCCATGCTCATCTAGG + Intronic
1063789203 10:9423052-9423074 GATATGTGCCAAGACCAGCTTGG + Intergenic
1070633937 10:78108829-78108851 ACTATGTGCCAGGCCCCACTAGG + Intergenic
1071737593 10:88318662-88318684 GCTCTGCCCCAAGACCATCTTGG + Intronic
1072528677 10:96297838-96297860 ACTATGTGCCAGGCACTTCTAGG - Intergenic
1072549439 10:96466213-96466235 GCTCAGTGCCAAGGCCAGCTGGG + Intronic
1073315702 10:102579262-102579284 GCTGTGTGCCCTGCCCATGTGGG + Intronic
1073566353 10:104538753-104538775 GCTAAGTGACAAGCCCAGGTAGG - Intergenic
1075355786 10:121773425-121773447 GTTTTGTTCCAGGCCCATCTTGG + Intronic
1076782709 10:132733079-132733101 GCCATGAGCCAGGGCCATCTGGG - Intronic
1077918346 11:6625393-6625415 GGTATGTGCTAAGCCCATCTGGG - Exonic
1079524523 11:21368681-21368703 GGTATGTCTTAAGCCCATCTTGG + Intronic
1082301219 11:50508934-50508956 GCCATTTGCCAAGACCAGCTTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1087130774 11:94667771-94667793 GCTACATGCCAAGCTCATCTTGG - Intergenic
1088506682 11:110534229-110534251 TCTATTTGCCAAGACCAGCTTGG + Intergenic
1102947855 12:117005682-117005704 ACTATGTGCCAAGGACATCATGG + Intronic
1105783742 13:23727222-23727244 TCTTTCTGCAAAGCCCATCTTGG + Intergenic
1111658674 13:91182148-91182170 GCTATGTGACAAACCCACTTAGG + Intergenic
1111809020 13:93074595-93074617 TCTATGTTTCAACCCCATCTTGG + Intergenic
1115959517 14:38819738-38819760 ACAATGTGCCAAGACCAGCTCGG - Intergenic
1117857669 14:60051936-60051958 GCTCTGTGCCACTCCCATGTGGG + Intronic
1118118150 14:62804794-62804816 GCTATGTGCCAGGCTAAACTAGG - Intronic
1118449881 14:65890628-65890650 GCTATGGTCAAAGCCCATCACGG + Intergenic
1118612797 14:67554537-67554559 ACCATGTGCCAAGCCTAGCTGGG - Intronic
1119879391 14:78088350-78088372 GCTATGAGCAGAGCCCTTCTGGG + Intergenic
1121099615 14:91241527-91241549 GCTCTTGACCAAGCCCATCTAGG - Intronic
1121465912 14:94115546-94115568 GCTCTGGGCCAAGCTCTTCTGGG - Intronic
1121482423 14:94289418-94289440 GCTATGTGCCAAGCCCATCTGGG + Intronic
1122138370 14:99647413-99647435 GCTATGTGCCAGGCTCAGCACGG + Intronic
1129792250 15:78349145-78349167 CCTAAGTGCCAAGACCAGCTTGG + Intergenic
1129836721 15:78712817-78712839 GACATGTTCCAAGCCCACCTCGG - Intronic
1129873503 15:78956895-78956917 TCTATGTGCCAGGGTCATCTGGG + Intergenic
1132330429 15:101008766-101008788 GCTTTATTCCAAGCCCATGTGGG + Intronic
1133235890 16:4387281-4387303 GCAGTGGGCCAAGGCCATCTCGG + Intronic
1133805797 16:9125234-9125256 GCTGTGTCACTAGCCCATCTTGG + Intergenic
1137506069 16:49055029-49055051 GCTATGTGCCTAACCTGTCTTGG + Intergenic
1137555769 16:49469359-49469381 GCTCTGTGCCAAGCCCGTGCTGG - Intergenic
1138303756 16:55955923-55955945 GCTCTGTGTCAAGGCCAGCTGGG - Exonic
1141396481 16:83709543-83709565 GCTATGTATAAAGCCCATGTGGG - Intronic
1142503904 17:350810-350832 GCTGTCAGCCAAGGCCATCTGGG + Intronic
1142927455 17:3253023-3253045 GCTATGGGCCAAAAACATCTTGG + Intergenic
1143013721 17:3880397-3880419 GCCCTGTGACAAGCCCTTCTCGG - Exonic
1144488508 17:15687226-15687248 ACTATGTGGCAAGCCCACCCAGG - Intergenic
1146593495 17:34149574-34149596 GCTATGTGCTAAGCAATTCTAGG + Intronic
1146723693 17:35141034-35141056 GCTATATGCTAATCCTATCTTGG - Intronic
1148906433 17:50915282-50915304 GCTATGTACCAAGTCCAGCGAGG + Intergenic
1151781731 17:76251142-76251164 GCAATGTACCCAGCCCTTCTGGG - Intergenic
1152298810 17:79483725-79483747 GCTATGTGCCAGGCACATCCTGG - Intronic
1152963950 18:97589-97611 GCACTGTGCTAAGCTCATCTCGG + Intergenic
1157196790 18:45626255-45626277 GCTATGTGCCAAGAAAATATTGG + Intronic
1157312298 18:46561313-46561335 GTTATGTGCTATGCCCATCCTGG - Intronic
1158527195 18:58225641-58225663 AATATGTACCAAGCCCATCAGGG + Intronic
1158555574 18:58472073-58472095 GCAATGTGCCAAGCATCTCTAGG + Intergenic
1161159625 19:2754759-2754781 GGTGTGTGCCAAGCCCACCCGGG - Exonic
1161367621 19:3889825-3889847 GCCATTTGCACAGCCCATCTCGG - Intronic
1162643055 19:12027798-12027820 CCTAAGTGCCAAGACCAGCTTGG - Intronic
1163143965 19:15368553-15368575 GCTGTGTCCCTAGCCCATCCTGG - Intronic
1167620517 19:50557492-50557514 GCTGTGTGCCAGGCCCTACTTGG - Intronic
925542902 2:4985386-4985408 GCTATTTGCCAAGGCCACCAAGG - Intergenic
926157760 2:10466994-10467016 AGCATGTGCCAAGGCCATCTTGG - Intergenic
926219198 2:10923980-10924002 GCTATGGGCCAGGGCCAACTAGG - Intergenic
930638631 2:53832627-53832649 TTTCTGTGCCATGCCCATCTAGG - Intergenic
930983025 2:57550914-57550936 GGTATGGGCCAAGCCCATGGAGG + Intergenic
934712685 2:96526326-96526348 GCTATGTGCCTGGCCCTTCTGGG + Intergenic
936045249 2:109182529-109182551 TCTATGTCCCAAGCACATCCAGG - Intronic
939904287 2:147891459-147891481 CCTATGGGCCAAATCCATCTTGG + Intronic
944813115 2:203347562-203347584 ACCATGTGCCAAGCCTTTCTGGG + Intronic
1172009047 20:31835934-31835956 GCTCTGGGCCCAGACCATCTGGG - Intergenic
1174203552 20:48823763-48823785 ATCATGTGCCAAGCCCTTCTTGG + Intronic
1174391268 20:50219714-50219736 ACTATGTGCCAAGCCCACGATGG - Intergenic
1175130938 20:56789052-56789074 GCTGTGTCCCAGGCCCATCCTGG + Intergenic
1179589780 21:42398936-42398958 GTTATCTTCCAAGCCCATCAGGG - Intergenic
1179722238 21:43322388-43322410 GCTGTGTGGCAAGGGCATCTGGG + Intergenic
1180723246 22:17925098-17925120 GGAATGAGCCAAGCCCATTTTGG - Intronic
1183120653 22:35727701-35727723 GCTATGTGCCAAGCACTGCTAGG - Intronic
952950210 3:38517421-38517443 GCTATGTTCCATGTTCATCTTGG + Intronic
956154115 3:66275504-66275526 GCTATGTGCCACACTCTTCTAGG - Intronic
957413896 3:79876038-79876060 TGTATGTGCAAAACCCATCTTGG - Intergenic
962186227 3:133262714-133262736 GCTGTGTGCCAAGCCCCACTAGG + Intronic
963237457 3:142969712-142969734 GCTAAGTGCAAAGATCATCTAGG - Intronic
968589779 4:1451570-1451592 ACTCTGTGCCAAGCCCTGCTGGG + Intergenic
972180167 4:36455130-36455152 GGTATGTGCCAAGCTTTTCTTGG + Intergenic
973880459 4:55266514-55266536 ACTATATGCCAAGCTCATCTGGG + Intergenic
974030793 4:56774627-56774649 GGTATAAGACAAGCCCATCTTGG + Intergenic
975389636 4:73801870-73801892 GCTTTGTGCCAATCCCAGGTGGG - Intergenic
975682156 4:76887386-76887408 ACCATGTGCCAAACCCTTCTAGG + Intergenic
989490577 5:42048084-42048106 GCTCTGTGTCAATCCCATGTGGG - Intergenic
989604125 5:43227656-43227678 GCTATTTCACAAGTCCATCTAGG + Intronic
992680521 5:79148405-79148427 GCTATGTGCCAAGAATATATTGG - Intronic
992810049 5:80377603-80377625 GCTTGGAGCCAAGCCCAGCTGGG + Intergenic
995766729 5:115626710-115626732 GCTATGTACCAACCACTTCTAGG - Intronic
997721779 5:136083729-136083751 ACTTTGTGCCAAGCCCTTCAGGG + Intergenic
998202315 5:140134922-140134944 GCTATGTGCCAGACTCATCTGGG - Intergenic
1003594351 6:7461155-7461177 ACTATGTGCCAAGCACTGCTTGG - Intergenic
1004931897 6:20470347-20470369 GCTATGTACCAAGCCCTGCATGG - Intronic
1005425967 6:25702633-25702655 TCTATGTGCCAAGTACTTCTAGG + Intergenic
1006011148 6:31044066-31044088 TCCATGTGTCAAGACCATCTGGG + Intergenic
1006491791 6:34393857-34393879 GCTATGTGCCAGGGCCAAGTAGG - Intronic
1008463545 6:51804292-51804314 GCTGTGTCCCAAGTCCCTCTAGG + Intronic
1015287504 6:131503314-131503336 CCAATGTGCCAGGCCCATTTAGG - Intergenic
1017421151 6:154274583-154274605 GCTATTGGCCATGCCCCTCTTGG + Intronic
1029596413 7:101539842-101539864 CCTATGTGTCAGGCCCAACTGGG + Intronic
1038570452 8:28657820-28657842 GCTAGCTGCCAAGCCAAGCTTGG - Intronic
1045850302 8:106687870-106687892 GCTCCGAACCAAGCCCATCTGGG - Intronic
1048458897 8:134603368-134603390 GCTGTGTTCCAAGCTGATCTAGG + Intronic
1049205685 8:141362440-141362462 GCTCTCTGCCAGGCCAATCTGGG - Intronic
1061886505 9:133593706-133593728 GCTGTGTGCCAAGCACAGCCCGG + Intergenic
1062734164 9:138126197-138126219 GCACTGTGCTAAGCTCATCTCGG - Intergenic
1198380837 X:136081959-136081981 GCTACGTGCCAAGCCCTACAAGG + Intergenic
1200367917 X:155687273-155687295 GCAATGTGCCAAGCCCAACTTGG + Intergenic