ID: 1121482907

View in Genome Browser
Species Human (GRCh38)
Location 14:94292156-94292178
Sequence CATTGTGATGGCAATAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121482901_1121482907 9 Left 1121482901 14:94292124-94292146 CCTGAGAATTAATAAGTTGAAGC 0: 1
1: 0
2: 1
3: 63
4: 673
Right 1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 152
1121482899_1121482907 11 Left 1121482899 14:94292122-94292144 CCCCTGAGAATTAATAAGTTGAA 0: 1
1: 0
2: 5
3: 58
4: 606
Right 1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 152
1121482900_1121482907 10 Left 1121482900 14:94292123-94292145 CCCTGAGAATTAATAAGTTGAAG 0: 1
1: 0
2: 4
3: 51
4: 490
Right 1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121482907 Original CRISPR CATTGTGATGGCAATAGAGT TGG Intronic
902103201 1:14011026-14011048 AATAGTGATGGCAATGGAGGAGG - Intergenic
902353995 1:15882823-15882845 CAGAGTGATGGCAGAAGAGTAGG + Intronic
903033132 1:20477472-20477494 CATGGTGATGGCAGTGGGGTGGG - Intergenic
904361258 1:29973632-29973654 CACTGTCATGGCAATTTAGTTGG + Intergenic
906115177 1:43352077-43352099 CATGGTCAAGGCAATAAAGTTGG - Intronic
906656763 1:47553967-47553989 CAGTGTGGTCGCAAGAGAGTGGG + Intergenic
907473177 1:54687737-54687759 CATTGTGTTGGCAAGGGTGTAGG - Intronic
907497864 1:54856879-54856901 CATTGTGCTGGCAAGGGAGAAGG - Intronic
907649600 1:56282404-56282426 AGTTGTGATGGCAGTAGAGGTGG - Intergenic
908065697 1:60401760-60401782 CATTCTGATTGCCATATAGTAGG + Intergenic
908087306 1:60649736-60649758 CATTGTGGTGGTAATTGAGGAGG + Intergenic
908217845 1:61973219-61973241 CATTGAGCTGACAAGAGAGTGGG + Intronic
909034402 1:70580933-70580955 CATGGTGATGGCAGCAGTGTGGG + Intergenic
909333186 1:74439717-74439739 CAGTGAGATGGCAAAAGAGGAGG + Intronic
909409064 1:75328191-75328213 CATTCTTTTGGCAAGAGAGTGGG - Intronic
909926440 1:81442966-81442988 TATTGTGAGAGCAACAGAGTAGG - Intronic
911137856 1:94461282-94461304 CTTTGTGATGGAGATAGGGTGGG + Intronic
914468536 1:147951335-147951357 AATTGTAATGGCAATATAATAGG - Intronic
915802211 1:158806332-158806354 CATTGTTATTACAATAGACTTGG - Intergenic
921400330 1:214715141-214715163 CATTGGGATGGCATCAGAGGTGG - Intergenic
923812894 1:237339966-237339988 CATGGGGATGGCAATAGGGAAGG + Intronic
1065641926 10:27791741-27791763 CATTATTATGGCAATAGATAAGG + Intergenic
1067429601 10:46234379-46234401 CACTGTGATGGCATTGGAATTGG + Intergenic
1070356247 10:75643179-75643201 CATTCTGATTTCAAGAGAGTAGG + Intronic
1070481149 10:76884060-76884082 TATTGTGATGGGAATGGAATGGG - Intronic
1071350955 10:84744089-84744111 CTTTGTGATGGCAGCAGAGATGG - Intergenic
1071464459 10:85926642-85926664 CTTTGTGCTGGCAATGGGGTGGG - Intronic
1073799663 10:107027395-107027417 CAATGTCATGTAAATAGAGTCGG - Intronic
1074574955 10:114659952-114659974 AATTGTGTTGCCAATAGATTAGG - Intronic
1078732280 11:13985850-13985872 CATTTTGATGGCACAAGGGTAGG - Intronic
1081847669 11:46252392-46252414 CATCGTCATGGCAATAGAGGAGG - Intergenic
1085043446 11:73340220-73340242 TATTGTCTTGGCAATGGAGTGGG - Intronic
1085876726 11:80416407-80416429 CACTGTGCTGGGAATACAGTGGG + Intergenic
1086188969 11:84055575-84055597 GAGTGTGATGGCTATAGTGTAGG - Intronic
1086595626 11:88567349-88567371 CATTGTGAAGGCGATATACTTGG + Exonic
1087450673 11:98318232-98318254 CATTGTGATGGTAATTGGGTAGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1093343392 12:18007727-18007749 CTGTGTGATGCCAATAGTGTGGG + Intergenic
1093406169 12:18807429-18807451 TATTGTGTGGGCAATGGAGTTGG + Intergenic
1095137047 12:38617299-38617321 CATTCTGATTTCAATAAAGTAGG - Intergenic
1095286382 12:40415911-40415933 GATTTTGATGGAAATGGAGTAGG + Intronic
1095909613 12:47413068-47413090 CAGTGGGATGGCAATAGTGGTGG - Intergenic
1098969971 12:76842849-76842871 CATAGTGGTGGCAAAAGAGTTGG + Intronic
1099553553 12:84079085-84079107 AATTCAGATGACAATAGAGTTGG + Intergenic
1099711785 12:86235852-86235874 CATAGTGATTGGAATAAAGTTGG + Intronic
1101307978 12:103549180-103549202 CAATGTGATAGAAATAGAGAAGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1104581728 12:130015831-130015853 CATGGTGCTGGCAATACATTAGG + Intergenic
1104613123 12:130246099-130246121 CATTGTGGTAGCAATGCAGTTGG - Intergenic
1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG + Intronic
1108736832 13:53293073-53293095 AACTGTCATGGCACTAGAGTGGG + Intergenic
1109591238 13:64485810-64485832 CCTTGTGAACCCAATAGAGTTGG - Intergenic
1109724306 13:66319213-66319235 CACTATCATGGCAATAGCGTGGG + Intronic
1111936716 13:94565425-94565447 CAGTGTGATGGTAATATAGATGG + Intergenic
1112035949 13:95496769-95496791 CAATGTGATGGCATTTGAGGTGG - Intronic
1112688739 13:101864341-101864363 CAAGGTGATGGTAACAGAGTTGG - Intronic
1114861900 14:26533373-26533395 TATTCTGATGGCAATAGGGAGGG - Intronic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1125231202 15:37458283-37458305 CATTATGATGGAAATAGTGTTGG - Intergenic
1129879969 15:78999887-78999909 CATTGTTATAGGAAAAGAGTGGG + Exonic
1129984163 15:79902304-79902326 TATTATGAAGGCAATAAAGTTGG + Intronic
1129991153 15:79964729-79964751 TATTATGAAGGCAATAAAGTTGG + Intronic
1131705805 15:94994352-94994374 CATTGTTATAGGAATAAAGTAGG + Intergenic
1134527133 16:14953173-14953195 CATAGTGCTGGCAAGAGAGGAGG - Intergenic
1135282498 16:21164819-21164841 CATTCTCATGGCAACAGAGGGGG - Intronic
1136997214 16:35198705-35198727 CATTGTGATGACAAGAGGGATGG - Intergenic
1142994350 17:3751922-3751944 CATCGGGGTGGCAATGGAGTGGG - Intronic
1143826081 17:9608748-9608770 CATTGTTATGGCAATAAATAAGG - Intronic
1148078464 17:44953801-44953823 CATTCTGCAGGCAACAGAGTAGG + Intergenic
1153705536 18:7741214-7741236 CATAGTGGTGGCCATACAGTAGG + Intronic
1156162554 18:34376987-34377009 CATTGTGATGGCATTAGAAATGG - Intergenic
1156825964 18:41430321-41430343 CATTGTGATGGACATAAACTGGG + Intergenic
1157312475 18:46562440-46562462 CATGGTGTTGGCAAGAGAGGAGG - Intronic
1158386282 18:56995858-56995880 CATTGTCATGGAGATAGAATGGG + Intronic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1166554288 19:43687908-43687930 CAGGGGGATGGCTATAGAGTGGG + Intergenic
1166854893 19:45778518-45778540 GATTGTCATGGCCATAGACTCGG - Exonic
1168334570 19:55590470-55590492 CATTCTGAAGGCAATAGGGAAGG - Intergenic
925430610 2:3789161-3789183 CAATGTGATGGAAAAATAGTGGG + Intronic
930517512 2:52426843-52426865 CATTTTGATGGCTATATAGAAGG - Intergenic
932958595 2:76385781-76385803 CATTGTGATGGCAGAATAGAAGG + Intergenic
934841419 2:97626542-97626564 CAGAGTGATGGCTAAAGAGTGGG - Intergenic
934984275 2:98873006-98873028 CAGTGTGATGTAAATAGACTGGG + Intronic
936344686 2:111666325-111666347 GGTTGTGATGGCAACAGAGGTGG + Intergenic
938405009 2:131027603-131027625 CATTGTGTTGGCTATAGTATAGG - Intronic
939059936 2:137409471-137409493 CATTGTGATGTAAAGAGAATGGG + Intronic
939569943 2:143829277-143829299 CACTCTGTTGGCAACAGAGTAGG + Intergenic
939594091 2:144103491-144103513 AATTGTTATGTAAATAGAGTTGG - Intronic
942184251 2:173408982-173409004 CAGTGGGAGGGCAAGAGAGTGGG + Intergenic
943635910 2:190306773-190306795 CAAGGTGATGGCATAAGAGTGGG + Intronic
944889865 2:204106300-204106322 CATTGTGATGGCAATGCTGTGGG - Intergenic
945839192 2:214868104-214868126 CATTGTAATAGCACTAGTGTAGG - Intergenic
946597329 2:221320598-221320620 CATTGTAAAGGCAACAAAGTTGG - Intergenic
947100799 2:226619342-226619364 GAATGTGACGGCAATAGAGGAGG + Intergenic
948794851 2:240397306-240397328 CATTGTGATGTCAGGAGAGCTGG - Intergenic
1168967948 20:1911116-1911138 CATTTTCATGGCTATAGACTTGG + Intronic
1171269279 20:23800787-23800809 AATGGTGATGGCAATGGTGTTGG - Intergenic
1172177124 20:32979331-32979353 CATTGTGAGGCCGATAGAGTAGG + Intergenic
1173289463 20:41701754-41701776 CTTGGTGATGGGAATGGAGTAGG - Intergenic
1178194526 21:30328471-30328493 GATTGTCAAAGCAATAGAGTTGG - Intergenic
1179204100 21:39257263-39257285 TATTGTTAAGGCAATACAGTAGG + Intronic
1183121255 22:35731820-35731842 CAGTGTGGTGGCAACAGAGGTGG + Intergenic
1183259811 22:36787335-36787357 CCTTTTGATGGCAATAAAGTTGG + Intergenic
1183725590 22:39587497-39587519 CATTTTCATGGCCATAAAGTGGG + Intronic
1183941943 22:41301035-41301057 CATCATGATGCCAATAAAGTCGG + Intergenic
949215048 3:1556719-1556741 TAATATGATGGCAATGGAGTGGG + Intergenic
951926715 3:27915796-27915818 CATGGAGATGGCATTATAGTAGG + Intergenic
952482279 3:33774014-33774036 TACTGTGATGGAAACAGAGTTGG - Intergenic
954227414 3:49191193-49191215 CATTGTGATGGCCAGAGGGCAGG - Intronic
955136526 3:56224442-56224464 CATGGTGATGGAAATAGAGATGG + Intronic
956216592 3:66855693-66855715 CAATGTCATGGCAATAGCATTGG + Intergenic
957340752 3:78893035-78893057 CAGTGTGATGGCAATGGGATGGG - Intronic
957608280 3:82432535-82432557 CAGTGTGATGGCATTGGAGGTGG - Intergenic
960097830 3:113704871-113704893 CATTGAGATGTCTATAGTGTTGG + Intergenic
965123406 3:164593455-164593477 GACAGTGGTGGCAATAGAGTTGG - Intergenic
967490051 3:190079994-190080016 CATTGTTATTATAATAGAGTAGG + Intronic
971877554 4:32325292-32325314 GATAGTGATGGCCATATAGTGGG - Intergenic
972352862 4:38253023-38253045 CTTTGTGATGGGAATATAATGGG - Intergenic
976575881 4:86670565-86670587 CACAGTGGTGGCAATAGAGGTGG - Intronic
977287971 4:95132864-95132886 TAGGGTGATGGCAATAGAGAAGG - Intronic
978863755 4:113482237-113482259 TAGAGTGATGGCAATGGAGTTGG + Intronic
979018580 4:115466420-115466442 CAGTGTGATGGTATTAGAATGGG + Intergenic
983545073 4:168954516-168954538 CATTGTGATAGTATTAGAGGTGG - Intronic
984017830 4:174446673-174446695 CAATGTGATGACAATACATTTGG + Intergenic
986054493 5:4122409-4122431 CATTTTGATGGCAGTGGTGTTGG + Intergenic
987609675 5:20186218-20186240 CATTGTCATGGCATTGGATTTGG + Intronic
988296716 5:29372726-29372748 CATTGTGTTAGCAACAGTGTGGG - Intergenic
988879834 5:35489589-35489611 CATTGTAATAGCAAAAAAGTTGG - Intergenic
990879104 5:60520274-60520296 CACTGTGATGGAAATGGGGTGGG - Intronic
991319468 5:65354209-65354231 CATTGTGATTGCAAATTAGTTGG - Intronic
996676583 5:126182173-126182195 CAAGGTGATGGCATTGGAGTTGG - Intergenic
999811204 5:155128961-155128983 CATAGTGATGTCACTAGAGAAGG - Intergenic
1000653682 5:163849799-163849821 CATTGTCCTGGCAAAAGAGCTGG + Intergenic
1000866484 5:166520828-166520850 GATTGTGATGGTAATAAAGCCGG - Intergenic
1001114990 5:168932007-168932029 CTTTGTGATGGCTACAGACTTGG - Intronic
1001814254 5:174654799-174654821 CATTGTGGTGGCATTAGAAGTGG + Intergenic
1002818522 6:700625-700647 CATTGTGATAGTAACAGAGTTGG + Intergenic
1003957142 6:11174464-11174486 CATGGAGATGGAAATAGCGTTGG + Intergenic
1005099160 6:22150729-22150751 CATTGTGAAGCCAACAGGGTAGG - Intergenic
1005816865 6:29560171-29560193 CATGGTGGTGGGGATAGAGTTGG - Intronic
1009490679 6:64286065-64286087 CATAGTGCTGGCAATATAGTGGG + Intronic
1012442410 6:99273167-99273189 CATTGTGATTGCAAAACAGAGGG + Exonic
1013176589 6:107683025-107683047 CATCTTGATGGGAGTAGAGTAGG - Intergenic
1013580576 6:111530263-111530285 CATGGGGATGTCAATAAAGTTGG + Intergenic
1014222398 6:118810814-118810836 CATTGTGATGTTAATAGGTTTGG + Intergenic
1017724999 6:157270615-157270637 GTTTGTGGTGGTAATAGAGTTGG - Intergenic
1022684830 7:32586824-32586846 CATTGTAATGACAATGGTGTAGG + Exonic
1027285070 7:76639024-76639046 CAATATGATGGCAATACAGAGGG + Intergenic
1033671139 7:143494428-143494450 CATTGTAATGACAATGGACTAGG + Intergenic
1034840874 7:154394930-154394952 CATTGGGATTGCGATAGAGATGG + Intronic
1034842529 7:154412519-154412541 CATTGTGATTGCATTAGAGATGG - Intronic
1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG + Intronic
1045512841 8:102826898-102826920 CAATTTGATGGCAATGGATTGGG + Exonic
1047756451 8:127922671-127922693 CACTGTGTTGGCAGTAGAGTGGG - Intergenic
1048434135 8:134400096-134400118 CAATGTGATGGTATTAGAGGTGG + Intergenic
1051089905 9:13394325-13394347 CAGTCTGATGGCAACAGAGTTGG - Intergenic
1052494206 9:29206392-29206414 CCTTGTGTTGGCAAGGGAGTGGG - Intergenic
1056739103 9:89237349-89237371 CAATGTGATGGTATTAGAGGGGG + Intergenic
1057568728 9:96187208-96187230 CTCTGTGCTGGCAATAAAGTTGG - Intergenic
1059343175 9:113611111-113611133 TAGTGTGAGGTCAATAGAGTGGG - Intergenic
1186444764 X:9617853-9617875 CATTCTCATGGCAATAAGGTGGG + Intronic
1188080680 X:25836351-25836373 CATTGTGAGGAAAATGGAGTTGG - Intergenic
1188877740 X:35451913-35451935 CACTGTGATGACAATAGCATGGG - Intergenic
1192226343 X:69230800-69230822 CAGTGTGAAGGCAGTAGAGTGGG - Intergenic
1194398309 X:93412854-93412876 AGTTGTGATGCCCATAGAGTTGG + Intergenic
1195404020 X:104492980-104493002 CATTGTGGGGGCAGTAGGGTAGG + Intergenic
1197491705 X:127124887-127124909 TATTTTTATGGCAATAGAGATGG - Intergenic
1199391721 X:147287732-147287754 AAGTGGGAGGGCAATAGAGTGGG - Intergenic
1199473783 X:148223980-148224002 CTTTATGATGGCTATAGAGTTGG - Intergenic
1200874877 Y:8143400-8143422 GACTGTGATGGCTACAGAGTGGG + Intergenic