ID: 1121484712

View in Genome Browser
Species Human (GRCh38)
Location 14:94305804-94305826
Sequence ATCCCACCAGACCACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121484712_1121484718 -2 Left 1121484712 14:94305804-94305826 CCCTCTGTGTGGTCTGGTGGGAT 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1121484718 14:94305825-94305847 ATGGGTAGGTGCCTGGCCTGTGG 0: 1
1: 0
2: 3
3: 23
4: 262
1121484712_1121484717 -9 Left 1121484712 14:94305804-94305826 CCCTCTGTGTGGTCTGGTGGGAT 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1121484717 14:94305818-94305840 TGGTGGGATGGGTAGGTGCCTGG 0: 1
1: 0
2: 4
3: 40
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121484712 Original CRISPR ATCCCACCAGACCACACAGA GGG (reversed) Intronic
900161532 1:1226422-1226444 ATCCCACAAGCCCAAACTGAGGG + Intronic
900848113 1:5120075-5120097 TTCCCAGCAGAACACACAGGGGG - Intergenic
900918254 1:5653255-5653277 AGCCCACCCGCCCAGACAGAAGG + Intergenic
906207049 1:43992372-43992394 CTCCCACCTGCCCTCACAGATGG - Exonic
906642104 1:47447340-47447362 TCCCCTCTAGACCACACAGAGGG + Intergenic
911720607 1:101187191-101187213 ATTCCACCACACCGTACAGATGG + Intergenic
913058196 1:115181266-115181288 ATCTTACAAGTCCACACAGATGG + Intergenic
914512563 1:148346714-148346736 GTCCCACCATTGCACACAGAGGG + Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
919256908 1:195137959-195137981 ATCCCAAGAGAACACAAAGAAGG - Intergenic
922810836 1:228414704-228414726 CTCCCTGCACACCACACAGATGG + Exonic
924456122 1:244220010-244220032 AGCCCAGCAGGGCACACAGAGGG + Intergenic
1064412473 10:15119086-15119108 ATGGCACCAGACCACACTCATGG + Intronic
1066416301 10:35224418-35224440 GCCCCACCAGACCACACCTAGGG + Intergenic
1067080462 10:43209600-43209622 ACCCCTACAGACCACACAGGAGG + Intronic
1071467854 10:85957512-85957534 ATCCCCCCAGACTACACATAAGG + Intronic
1072726183 10:97815561-97815583 TTCCCACCATACCACACCTAAGG - Intergenic
1072935159 10:99704952-99704974 AACACACCAGACCTCTCAGAAGG - Exonic
1075143296 10:119861059-119861081 AAACCACCAAACCACACAGCTGG + Intronic
1075380834 10:122017280-122017302 ATCACAGCAGCGCACACAGATGG + Intronic
1075469580 10:122678089-122678111 ACCCCACCAGGACACACACAGGG - Intergenic
1075477774 10:122751199-122751221 ATCACAGCACACCATACAGAGGG + Intergenic
1080271940 11:30459745-30459767 ACCCAACCTGACCACACATATGG - Intronic
1085083707 11:73652941-73652963 ATCCCACCAGACCATGAGGAGGG - Intronic
1085821804 11:79801794-79801816 ATTCAACCAGACCACACAGCTGG - Intergenic
1088481222 11:110297543-110297565 ATCCCAGCAGACAATACTGAGGG - Intergenic
1088811812 11:113397389-113397411 ATCACAACAGTCCACACAGCGGG - Intronic
1090632192 11:128659501-128659523 CTCACACCATACCATACAGAAGG + Intergenic
1091919090 12:4290037-4290059 ATCCCCCCGGACCATCCAGAGGG - Intronic
1100743203 12:97617922-97617944 ATCCCAACAGACCATAAACATGG - Intergenic
1103231776 12:119337203-119337225 ATCTCAAAATACCACACAGAAGG + Intronic
1105572427 13:21615699-21615721 AGGCCACCAGTCCATACAGAAGG + Intergenic
1107300219 13:38958234-38958256 TTCCCACCAGACCAGATAGGTGG + Intergenic
1108432832 13:50371583-50371605 ATCCCATCAGAACACACTGTGGG + Intronic
1112101632 13:96196335-96196357 ATCCCAACAGACTATACACATGG - Intronic
1112569555 13:100581376-100581398 AACCCACCAGCCCACAAAGATGG + Intronic
1115954143 14:38758856-38758878 ATCTTTCCAGACCACAAAGAGGG + Intergenic
1120720264 14:87882768-87882790 GTCCAACCTGACCACACAGTTGG + Intronic
1121484712 14:94305804-94305826 ATCCCACCAGACCACACAGAGGG - Intronic
1122076613 14:99239063-99239085 ATCCAACCAGAGTCCACAGAGGG + Intronic
1122354883 14:101116949-101116971 TTCCCACCAGACTGCACAAAAGG + Intergenic
1122734421 14:103828602-103828624 ATGCCACGAGATCCCACAGAAGG + Intronic
1123460339 15:20464709-20464731 ATCCCAAAAGCCCACACACAAGG + Intergenic
1123657723 15:22535708-22535730 ATCCCAAAAGCCCACACACAAGG - Intergenic
1124062170 15:26304103-26304125 ATGCCACCAGCCCACACACATGG - Intergenic
1124269755 15:28269760-28269782 ATCCCAAAAGCCCACACACAAGG + Intronic
1124311632 15:28630906-28630928 ATCCCAAAAGCCCACACACAAGG - Intergenic
1124923481 15:34048322-34048344 AGTCAACCAAACCACACAGATGG - Intronic
1125179491 15:36866195-36866217 ATCCCACCAGAGAACTCAGCAGG - Intergenic
1125281058 15:38043153-38043175 ATCCCACAACAAAACACAGAGGG + Intergenic
1126956643 15:53940059-53940081 AACCATCCAGACCACACAGAGGG - Intergenic
1129322763 15:74783756-74783778 TTCCTGCCACACCACACAGATGG - Intronic
1130647369 15:85740964-85740986 ATCCCTCCCGACCCCACAGCAGG - Intronic
1133269173 16:4602261-4602283 GTCCCACCTCCCCACACAGAAGG - Intergenic
1136704753 16:32177885-32177907 ATCCCAAAAGCCCACACACAAGG + Intergenic
1136763160 16:32751522-32751544 ATCCCAAAAGCCCACACACAAGG - Intergenic
1136804940 16:33118864-33118886 ATCCCAAAAGCCCACACACAAGG + Intergenic
1137621941 16:49882013-49882035 ATTTCACCAGGCCACACAGCTGG + Intergenic
1138334583 16:56242868-56242890 AACCCACCAGGCCATACAGCAGG + Intronic
1139517997 16:67463147-67463169 ATCCCACGAGCCCAAACACAGGG - Intronic
1142013676 16:87731726-87731748 AAAACACCAGTCCACACAGACGG + Intronic
1203065312 16_KI270728v1_random:1011844-1011866 ATCCCAAAAGCCCACACACAAGG - Intergenic
1143263958 17:5621681-5621703 ATCCCATCAGTCCCCACATATGG - Intergenic
1146529668 17:33597762-33597784 ATCCCACAGGGCCACACAGCAGG + Intronic
1148866079 17:50629375-50629397 AACCCTCCAGGCCACAGAGAGGG - Intergenic
1148996930 17:51718710-51718732 ATAGCAACAGACCCCACAGATGG - Intronic
1149019517 17:51946906-51946928 ATGCTACCACACCACACAGCTGG + Intronic
1150830021 17:68511524-68511546 ATCACTCCTGACCTCACAGAGGG - Intergenic
1151364613 17:73609142-73609164 ATCCCAACTGAACACACACAAGG - Intronic
1153417638 18:4866286-4866308 ATTCAACCATAACACACAGAAGG + Intergenic
1160865889 19:1255751-1255773 AGCCCACCAGCTCACACAGAGGG - Intronic
1161807887 19:6455555-6455577 TTCTCACCAGATCCCACAGACGG + Intronic
1162530178 19:11231363-11231385 AGCCCCCAAGACCACCCAGAGGG + Intronic
1162866403 19:13551142-13551164 ATCCCATCATTCCACAAAGAGGG - Intronic
1167259971 19:48452806-48452828 AGACCACCAGATCACACAGTGGG + Exonic
926315852 2:11708997-11709019 ATTGCTCAAGACCACACAGATGG + Intronic
929289580 2:40174146-40174168 ATCCCACCACACCAATCTGAGGG - Intronic
931184131 2:59933276-59933298 AGCACACCAGACCAGCCAGATGG + Intergenic
931571335 2:63671970-63671992 ATCCCACCTCCCCACAGAGACGG - Intronic
932120276 2:69092595-69092617 TTGCTACCTGACCACACAGATGG + Intronic
932654708 2:73600550-73600572 ATCCCTCCATCCCACACAAAGGG + Intronic
936247714 2:110843052-110843074 ACCCCACCATACCACACAGTTGG - Intronic
938130823 2:128714529-128714551 AGCCCCACAGACCACACAGGAGG - Intergenic
938395473 2:130944160-130944182 ACCACAACAGATCACACAGAGGG - Intronic
938577986 2:132621409-132621431 GTCTCAGCAGACCACACAGAGGG + Intronic
940057096 2:149525226-149525248 AGTCCACCAAACCACAGAGATGG + Intergenic
1168896872 20:1329606-1329628 ATTCAAGCAGACCACAGAGATGG - Intronic
1169926334 20:10788211-10788233 TTCTCACCAGCCCACACACAGGG - Intergenic
1171045121 20:21803303-21803325 CTCCCACCACAGCAGACAGAAGG + Intergenic
1171204153 20:23266193-23266215 TCCCCACCAGACCGCAGAGAAGG - Intergenic
1171897478 20:30822121-30822143 ATGCCAAAAGCCCACACAGATGG - Intergenic
1177846480 21:26294210-26294232 AACACACCACACCACACAAAAGG - Intergenic
1178523324 21:33304008-33304030 AGCCCACCTGACCAGGCAGAGGG + Intergenic
1180924473 22:19544321-19544343 ACCAGACCATACCACACAGAGGG + Intergenic
1181344288 22:22206852-22206874 ATCCCAGCAGACAACAACGAGGG - Intergenic
1184433060 22:44452936-44452958 ATCCACACAGACCAGACAGAGGG + Intergenic
1184875933 22:47275588-47275610 ATCCCCCCACACCACTCAGGCGG - Intergenic
1185071893 22:48661226-48661248 GTCCCACCAGAGCGCAGAGAGGG + Intronic
1185275494 22:49948804-49948826 ATCCCACCAGCCCAGCAAGAGGG + Intergenic
949875539 3:8623942-8623964 ACCCCACGAGTCCACACTGACGG - Intronic
951267361 3:20584718-20584740 ATCCAACAAGAACACACAGTAGG - Intergenic
952616404 3:35278477-35278499 AGTCTACCAAACCACACAGATGG - Intergenic
952684510 3:36132835-36132857 CTCCAACCAGACCACCCAGCTGG + Intergenic
955019407 3:55104635-55104657 ATCCCACCAGCCTACAAAGAAGG + Intergenic
955229979 3:57090152-57090174 ATCCCACTAGATCCCACAAAGGG + Exonic
955289636 3:57679300-57679322 TTCCCACCTGCCCTCACAGAAGG + Intronic
957039728 3:75327861-75327883 ACCCCAAAAGCCCACACAGATGG + Intergenic
957127227 3:76177545-76177567 ATCCCACCAGATGACCCAGCAGG - Intronic
960712674 3:120546527-120546549 AGACCACCAGCCCACACAGTTGG - Intergenic
960845470 3:122000750-122000772 ATAGCACCAGACCCCACAGGTGG - Intronic
961044479 3:123699295-123699317 ACCCCAAAAGTCCACACAGATGG + Intronic
961475148 3:127141392-127141414 ATGCCACCACCCCACACACAGGG - Intergenic
963777860 3:149457966-149457988 ATCCCACCTGCCCACACACCAGG - Intergenic
965065951 3:163849160-163849182 ATCCCAGCAGACTACAAATAGGG - Intergenic
968623445 4:1615056-1615078 ACCCCACCTGGGCACACAGAAGG + Intergenic
969579747 4:8057862-8057884 ATCCCTGGAGGCCACACAGAGGG + Intronic
982423018 4:155220385-155220407 ATCCCATCAGACCATATTGAGGG + Intergenic
984494267 4:180475011-180475033 TTCTCACCAGAGCAAACAGAAGG - Intergenic
986405669 5:7422482-7422504 ATCCTTCCTGACCACACTGATGG - Intronic
987084861 5:14458876-14458898 CTCCTTCCAGACCACACCGAAGG + Intronic
991081014 5:62599257-62599279 ATCCCTCCTGTGCACACAGATGG + Intronic
992945288 5:81803530-81803552 ATTCCACTAGCCCACACAGGTGG + Intergenic
993586769 5:89740844-89740866 ATCCCAACACACAACTCAGATGG - Intergenic
994677743 5:102846370-102846392 GTACAACCAGAACACACAGAGGG - Intronic
998526140 5:142844979-142845001 ATCCCTCCAGTCCTCACAGAGGG - Intronic
1000161148 5:158598765-158598787 ATCCCACCATTCCACAAGGATGG - Intergenic
1004945077 6:20603489-20603511 ATCCCAGGAGACCATACACATGG - Intronic
1005286697 6:24335519-24335541 ATCCCACCACCACCCACAGAAGG + Intronic
1011552957 6:88546645-88546667 AGCCTGCCTGACCACACAGAAGG - Intergenic
1012009220 6:93759264-93759286 ATCTCACCAAAAGACACAGATGG + Intergenic
1012441965 6:99269179-99269201 CTGCTATCAGACCACACAGAAGG - Intergenic
1013098274 6:106966061-106966083 AACCCACCAGACCATAAAGTTGG + Intergenic
1015681997 6:135818581-135818603 TCTCCACTAGACCACACAGAAGG - Intergenic
1015788347 6:136941305-136941327 CTCCCACCAGCCCACACATAGGG - Intergenic
1017157159 6:151332812-151332834 ATCCCACTAGGTCACAAAGATGG - Intronic
1017477818 6:154816097-154816119 ATTAAACCAGACCACACATAGGG - Intronic
1017826918 6:158088548-158088570 GTCCCAGCAGACCACAGACACGG - Intronic
1019127899 6:169853381-169853403 ATGCCAACACACCACACAAATGG - Intergenic
1019428449 7:987963-987985 ACCCCCCCAGGACACACAGAGGG - Intronic
1020843852 7:13257823-13257845 ATTCCACAAAACCACACAGCCGG - Intergenic
1022052727 7:26694272-26694294 AATCCATCAAACCACACAGATGG + Intronic
1027653793 7:80903951-80903973 ATCCCACCATTAGACACAGAGGG + Intronic
1029633419 7:101767809-101767831 ATCCCAGCAAACTGCACAGATGG + Intergenic
1029694263 7:102202624-102202646 ATCCCATCTGATCACACAGAGGG + Intronic
1030982759 7:116206225-116206247 AGTACACCAGAACACACAGAGGG + Intergenic
1034078812 7:148257763-148257785 ATCCTCCCAGACCACATCGATGG - Intronic
1034644494 7:152633245-152633267 ATCCCATGAGACCACGCAGTCGG - Intergenic
1034715397 7:153236918-153236940 ATCCCAGCAGAGCCCAAAGAGGG + Intergenic
1035477671 7:159154940-159154962 AACTCAACTGACCACACAGATGG + Intergenic
1035867333 8:3099201-3099223 AACCATCCAGACCACACAGAGGG + Intronic
1035962091 8:4148582-4148604 CTCTCACCAGACCAGACAGCTGG - Intronic
1037423942 8:18733909-18733931 TTCAAATCAGACCACACAGAAGG + Intronic
1042473230 8:69214921-69214943 ATCCCAGCATACCAGACTGACGG - Intergenic
1043875769 8:85484492-85484514 CTCATACCAGCCCACACAGATGG + Intergenic
1047411554 8:124628515-124628537 CTCCCACCAGCCCCCACAGCAGG + Intronic
1048286231 8:133143732-133143754 TTTTCACCAGGCCACACAGAGGG - Intergenic
1049217576 8:141415170-141415192 CTTCCACCTGCCCACACAGAAGG - Intronic
1050231992 9:3536300-3536322 ATGCCACCAAGCCACACACATGG + Intergenic
1056595882 9:88007224-88007246 ACCCCACCACACCACACCGAGGG - Intergenic
1056601764 9:88052414-88052436 AGCCCACTAGCACACACAGATGG - Intergenic
1059116259 9:111602551-111602573 ATCCCACCAGACCAATGAAATGG - Intergenic
1059969816 9:119654392-119654414 GTCCACCAAGACCACACAGATGG + Intergenic
1060487157 9:124055009-124055031 ATCCCAACAAACCACAAAGAGGG - Intergenic
1062405628 9:136394941-136394963 ATCCCTCCAGAGCCCACAAAAGG + Intronic
1062592886 9:137281888-137281910 GTCCCAGGAGCCCACACAGAGGG + Exonic
1186165838 X:6825126-6825148 ATCCTACAAGAGCACGCAGAGGG + Intergenic
1187677909 X:21736355-21736377 CTCCCACCACACCTTACAGATGG - Intronic
1190131832 X:47755001-47755023 ATACCACCAGACCCCATACAGGG + Intergenic
1190533675 X:51406450-51406472 AACCCACCAGACCCCACATGGGG + Intergenic
1190558497 X:51663277-51663299 ATCCCGCAGGAGCACACAGATGG - Intergenic
1191754595 X:64580563-64580585 AACCATCCAGACCACACAGGGGG - Intergenic
1192126950 X:68509976-68509998 TGCACACCACACCACACAGATGG - Intronic
1195884802 X:109626527-109626549 ACCTCACCTGAACACACAGAAGG - Intronic