ID: 1121490286

View in Genome Browser
Species Human (GRCh38)
Location 14:94353845-94353867
Sequence TCAAGTTAAACGAGATTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490286_1121490291 30 Left 1121490286 14:94353845-94353867 CCTAATAATCTCGTTTAACTTGA No data
Right 1121490291 14:94353898-94353920 ATGCTCACAATCTGAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490286 Original CRISPR TCAAGTTAAACGAGATTATT AGG (reversed) Intergenic
No off target data available for this crispr