ID: 1121490287

View in Genome Browser
Species Human (GRCh38)
Location 14:94353871-94353893
Sequence TGGAGATTGGGACTTTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490287_1121490292 5 Left 1121490287 14:94353871-94353893 CCTCTGTAAAGTCCCAATCTCCA No data
Right 1121490292 14:94353899-94353921 TGCTCACAATCTGAGATATTGGG No data
1121490287_1121490291 4 Left 1121490287 14:94353871-94353893 CCTCTGTAAAGTCCCAATCTCCA No data
Right 1121490291 14:94353898-94353920 ATGCTCACAATCTGAGATATTGG No data
1121490287_1121490293 6 Left 1121490287 14:94353871-94353893 CCTCTGTAAAGTCCCAATCTCCA No data
Right 1121490293 14:94353900-94353922 GCTCACAATCTGAGATATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490287 Original CRISPR TGGAGATTGGGACTTTACAG AGG (reversed) Intergenic
No off target data available for this crispr