ID: 1121490288

View in Genome Browser
Species Human (GRCh38)
Location 14:94353883-94353905
Sequence GTGAGCATATTTTGGAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490288_1121490291 -8 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490291 14:94353898-94353920 ATGCTCACAATCTGAGATATTGG No data
1121490288_1121490294 22 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490294 14:94353928-94353950 AACTTCAACATAAGAATTTTTGG 0: 5
1: 37
2: 395
3: 1635
4: 3658
1121490288_1121490292 -7 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490292 14:94353899-94353921 TGCTCACAATCTGAGATATTGGG No data
1121490288_1121490293 -6 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490293 14:94353900-94353922 GCTCACAATCTGAGATATTGGGG No data
1121490288_1121490295 23 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490295 14:94353929-94353951 ACTTCAACATAAGAATTTTTGGG No data
1121490288_1121490296 24 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490296 14:94353930-94353952 CTTCAACATAAGAATTTTTGGGG 0: 5
1: 54
2: 471
3: 1769
4: 3645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490288 Original CRISPR GTGAGCATATTTTGGAGATT GGG (reversed) Intergenic
No off target data available for this crispr