ID: 1121490289

View in Genome Browser
Species Human (GRCh38)
Location 14:94353884-94353906
Sequence TGTGAGCATATTTTGGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490289_1121490295 22 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490295 14:94353929-94353951 ACTTCAACATAAGAATTTTTGGG No data
1121490289_1121490294 21 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490294 14:94353928-94353950 AACTTCAACATAAGAATTTTTGG No data
1121490289_1121490293 -7 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490293 14:94353900-94353922 GCTCACAATCTGAGATATTGGGG No data
1121490289_1121490292 -8 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490292 14:94353899-94353921 TGCTCACAATCTGAGATATTGGG No data
1121490289_1121490296 23 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490296 14:94353930-94353952 CTTCAACATAAGAATTTTTGGGG No data
1121490289_1121490291 -9 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490291 14:94353898-94353920 ATGCTCACAATCTGAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490289 Original CRISPR TGTGAGCATATTTTGGAGAT TGG (reversed) Intergenic