ID: 1121490290

View in Genome Browser
Species Human (GRCh38)
Location 14:94353891-94353913
Sequence CTCAGATTGTGAGCATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490290_1121490294 14 Left 1121490290 14:94353891-94353913 CCAAAATATGCTCACAATCTGAG No data
Right 1121490294 14:94353928-94353950 AACTTCAACATAAGAATTTTTGG No data
1121490290_1121490296 16 Left 1121490290 14:94353891-94353913 CCAAAATATGCTCACAATCTGAG No data
Right 1121490296 14:94353930-94353952 CTTCAACATAAGAATTTTTGGGG No data
1121490290_1121490295 15 Left 1121490290 14:94353891-94353913 CCAAAATATGCTCACAATCTGAG No data
Right 1121490295 14:94353929-94353951 ACTTCAACATAAGAATTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490290 Original CRISPR CTCAGATTGTGAGCATATTT TGG (reversed) Intergenic