ID: 1121490293

View in Genome Browser
Species Human (GRCh38)
Location 14:94353900-94353922
Sequence GCTCACAATCTGAGATATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490289_1121490293 -7 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490293 14:94353900-94353922 GCTCACAATCTGAGATATTGGGG No data
1121490288_1121490293 -6 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490293 14:94353900-94353922 GCTCACAATCTGAGATATTGGGG No data
1121490287_1121490293 6 Left 1121490287 14:94353871-94353893 CCTCTGTAAAGTCCCAATCTCCA No data
Right 1121490293 14:94353900-94353922 GCTCACAATCTGAGATATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490293 Original CRISPR GCTCACAATCTGAGATATTG GGG Intergenic
No off target data available for this crispr