ID: 1121490294

View in Genome Browser
Species Human (GRCh38)
Location 14:94353928-94353950
Sequence AACTTCAACATAAGAATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5730
Summary {0: 5, 1: 37, 2: 395, 3: 1635, 4: 3658}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490289_1121490294 21 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490294 14:94353928-94353950 AACTTCAACATAAGAATTTTTGG 0: 5
1: 37
2: 395
3: 1635
4: 3658
1121490288_1121490294 22 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490294 14:94353928-94353950 AACTTCAACATAAGAATTTTTGG 0: 5
1: 37
2: 395
3: 1635
4: 3658
1121490290_1121490294 14 Left 1121490290 14:94353891-94353913 CCAAAATATGCTCACAATCTGAG No data
Right 1121490294 14:94353928-94353950 AACTTCAACATAAGAATTTTTGG 0: 5
1: 37
2: 395
3: 1635
4: 3658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490294 Original CRISPR AACTTCAACATAAGAATTTT TGG Intergenic
Too many off-targets to display for this crispr