ID: 1121490296

View in Genome Browser
Species Human (GRCh38)
Location 14:94353930-94353952
Sequence CTTCAACATAAGAATTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5944
Summary {0: 5, 1: 54, 2: 471, 3: 1769, 4: 3645}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121490289_1121490296 23 Left 1121490289 14:94353884-94353906 CCAATCTCCAAAATATGCTCACA No data
Right 1121490296 14:94353930-94353952 CTTCAACATAAGAATTTTTGGGG 0: 5
1: 54
2: 471
3: 1769
4: 3645
1121490290_1121490296 16 Left 1121490290 14:94353891-94353913 CCAAAATATGCTCACAATCTGAG No data
Right 1121490296 14:94353930-94353952 CTTCAACATAAGAATTTTTGGGG 0: 5
1: 54
2: 471
3: 1769
4: 3645
1121490288_1121490296 24 Left 1121490288 14:94353883-94353905 CCCAATCTCCAAAATATGCTCAC No data
Right 1121490296 14:94353930-94353952 CTTCAACATAAGAATTTTTGGGG 0: 5
1: 54
2: 471
3: 1769
4: 3645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121490296 Original CRISPR CTTCAACATAAGAATTTTTG GGG Intergenic
Too many off-targets to display for this crispr