ID: 1121491616

View in Genome Browser
Species Human (GRCh38)
Location 14:94365148-94365170
Sequence CAGAAGGAGGAGACGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121491606_1121491616 12 Left 1121491606 14:94365113-94365135 CCTCAGGGACCCTTGAGCTCAGC No data
Right 1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG No data
1121491604_1121491616 27 Left 1121491604 14:94365098-94365120 CCAAGTGGGCAGGTGCCTCAGGG No data
Right 1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG No data
1121491608_1121491616 2 Left 1121491608 14:94365123-94365145 CCTTGAGCTCAGCTTTCTCATTG No data
Right 1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG No data
1121491607_1121491616 3 Left 1121491607 14:94365122-94365144 CCCTTGAGCTCAGCTTTCTCATT No data
Right 1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121491616 Original CRISPR CAGAAGGAGGAGACGGGGGC TGG Intergenic
No off target data available for this crispr