ID: 1121492271

View in Genome Browser
Species Human (GRCh38)
Location 14:94369089-94369111
Sequence CAGGTAGGAGAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121492256_1121492271 26 Left 1121492256 14:94369040-94369062 CCTTCAGGACCTGTGAGGGCCCC No data
Right 1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG No data
1121492258_1121492271 17 Left 1121492258 14:94369049-94369071 CCTGTGAGGGCCCCAGCAGGTAG No data
Right 1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG No data
1121492262_1121492271 6 Left 1121492262 14:94369060-94369082 CCCAGCAGGTAGAGGAGCGGACC No data
Right 1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG No data
1121492261_1121492271 7 Left 1121492261 14:94369059-94369081 CCCCAGCAGGTAGAGGAGCGGAC No data
Right 1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG No data
1121492263_1121492271 5 Left 1121492263 14:94369061-94369083 CCAGCAGGTAGAGGAGCGGACCA No data
Right 1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121492271 Original CRISPR CAGGTAGGAGAGAGGGAAGA GGG Intergenic
No off target data available for this crispr