ID: 1121492751

View in Genome Browser
Species Human (GRCh38)
Location 14:94371855-94371877
Sequence TCCTGCTGTCCCTCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121492746_1121492751 1 Left 1121492746 14:94371831-94371853 CCAGGCTCAGTGAGGGACCTGCC No data
Right 1121492751 14:94371855-94371877 TCCTGCTGTCCCTCCTCAGGAGG No data
1121492742_1121492751 24 Left 1121492742 14:94371808-94371830 CCTGCTGTACAGAGAGAGAGACT No data
Right 1121492751 14:94371855-94371877 TCCTGCTGTCCCTCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121492751 Original CRISPR TCCTGCTGTCCCTCCTCAGG AGG Intergenic
No off target data available for this crispr