ID: 1121495515

View in Genome Browser
Species Human (GRCh38)
Location 14:94389270-94389292
Sequence GATGCAGGTGAAACAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121495515_1121495522 26 Left 1121495515 14:94389270-94389292 CCAGGAACTGTTTCACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1121495522 14:94389319-94389341 AGCATGCTTGTGAAGTGCCTCGG 0: 1
1: 0
2: 1
3: 9
4: 157
1121495515_1121495523 27 Left 1121495515 14:94389270-94389292 CCAGGAACTGTTTCACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1121495523 14:94389320-94389342 GCATGCTTGTGAAGTGCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121495515 Original CRISPR GATGCAGGTGAAACAGTTCC TGG (reversed) Intronic
902145845 1:14398447-14398469 AATGCACCTGAAACAGTGCCTGG + Intergenic
902228269 1:15010716-15010738 GATTCAGGTGTCACAGGTCCTGG - Intronic
902665855 1:17937506-17937528 GGTGCAGAGGAAAGAGTTCCTGG - Intergenic
905972759 1:42153989-42154011 GATGATGGGGAAACTGTTCCAGG + Intronic
907071482 1:51539591-51539613 GATACATGTAAAACAGTTCCTGG - Intergenic
907733715 1:57091796-57091818 AATACACTTGAAACAGTTCCTGG + Intronic
908588174 1:65597386-65597408 GATGCAAGCAGAACAGTTCCAGG - Intronic
909112698 1:71499886-71499908 GATGCAGGTTAAACAGTTATTGG - Intronic
911484504 1:98488755-98488777 GATACAGGTGAAAATGTTCTTGG + Intergenic
914980365 1:152409880-152409902 GAGGCAGGAGAGACAGTACCGGG - Exonic
917229081 1:172816569-172816591 GATGAAGCTGAAAAAGTTCTGGG + Intergenic
917455553 1:175182812-175182834 GATGTGGGTGAAACAGTGCCTGG + Intronic
920864280 1:209738826-209738848 GATGCAAGTGATGCAGTTGCAGG + Intergenic
923962177 1:239098128-239098150 GAAGCTGATGAAACTGTTCCCGG + Intergenic
924798237 1:247308514-247308536 GCTGCAGGTGCCAGAGTTCCAGG - Exonic
1063915831 10:10881056-10881078 CATGCATGTTAAACAGTTTCTGG - Intergenic
1064133105 10:12727722-12727744 GACACATGTGAAACATTTCCTGG - Intronic
1064868227 10:19906434-19906456 GAGGCAGGGGAAACAGATTCTGG + Intronic
1065208211 10:23377052-23377074 GATGAAGGTGAAAAAATTCGAGG + Intergenic
1067234702 10:44437816-44437838 GATGCAGGAAAAACAGTTTATGG - Intergenic
1067495812 10:46759104-46759126 CAGGAAGGGGAAACAGTTCCAGG + Intergenic
1067858027 10:49814308-49814330 GAGGCAGGAGAATCACTTCCGGG - Intergenic
1067948502 10:50707864-50707886 CAGGAAGGGGAAACAGTTCCAGG - Intergenic
1070883823 10:79872861-79872883 CAGGAAGGGGAAACAGTTCCAGG - Intergenic
1071650379 10:87389163-87389185 CAGGAAGGGGAAACAGTTCCAGG - Intergenic
1072485266 10:95848484-95848506 TATGAAGATGAGACAGTTCCTGG - Intronic
1074036611 10:109745476-109745498 CAGCCAGGTGTAACAGTTCCAGG + Intergenic
1075608317 10:123832217-123832239 GATGCAGGAGATGCAGTTCCTGG - Intronic
1076905840 10:133360585-133360607 GATGCAGGTGAACCTGTCCTTGG + Intergenic
1077368053 11:2169214-2169236 GAGGCAGGTGACCCAGCTCCCGG - Intronic
1077446376 11:2592938-2592960 GATCCAGGAAAGACAGTTCCAGG - Intronic
1077574952 11:3375907-3375929 GGTGCTGGTGAGAGAGTTCCTGG + Intronic
1077827059 11:5822296-5822318 GAGGCAGATGATACGGTTCCTGG + Intronic
1078011865 11:7578614-7578636 GATGTAGGTGAAACAGTCCCAGG + Intronic
1078762025 11:14259362-14259384 GAGGTATGTGAAGCAGTTCCCGG + Exonic
1078909487 11:15717797-15717819 GATGCAGCTGAAATAGATGCAGG - Intergenic
1080285180 11:30602813-30602835 GATGCTGGTGACACAGTATCTGG - Intergenic
1081546473 11:44075482-44075504 GATGAAGATGAACCAGTTCCAGG - Intronic
1084379014 11:68798759-68798781 GCTGCAGGAGAAACAGCTCACGG + Intronic
1085055062 11:73398526-73398548 GGTGCAGGTGAAACATCTCCTGG - Intergenic
1085455066 11:76660957-76660979 GATGCAGGTGAGGGAATTCCTGG + Exonic
1085841824 11:80020365-80020387 TATGCAGGAGAAACTGTTCTAGG - Intergenic
1087672138 11:101119995-101120017 GAAGCAGTTAAAACAGTGCCTGG + Intronic
1087795834 11:102453963-102453985 GCTGCAGGGGAAACATTTGCAGG - Intronic
1089503590 11:118947958-118947980 GATCCAGGTGAAAAAGTTCATGG - Intronic
1089629122 11:119772889-119772911 GATGGAGGTGACACAGTCACAGG - Intergenic
1089840710 11:121414986-121415008 GATGAAGGTGAAAATGTTGCTGG - Intergenic
1091011529 11:132005758-132005780 GATGCAGGTGAAACAGAAAATGG - Intronic
1091079875 11:132656392-132656414 AATGCACGTGACACAATTCCTGG + Intronic
1091258565 11:134214397-134214419 GATGCAGATGAAGCTGTACCTGG + Intronic
1093119110 12:15246241-15246263 TATGAGGATGAAACAGTTCCTGG + Intronic
1094471639 12:30807089-30807111 TATGAAGATGAGACAGTTCCTGG + Intergenic
1099323731 12:81184278-81184300 GATGCAGCAAAAGCAGTTCCAGG + Intronic
1100795780 12:98180388-98180410 TATGTAGGTGATATAGTTCCTGG + Intergenic
1103211639 12:119171361-119171383 GATACAGGTCACAAAGTTCCAGG - Intergenic
1103275515 12:119708265-119708287 GAAGAAAGTGAAACAGTCCCTGG - Exonic
1105755057 13:23456300-23456322 CATGCAGCTGAGTCAGTTCCTGG + Intergenic
1108157713 13:47603583-47603605 TATGAAGATGAGACAGTTCCTGG + Intergenic
1112882704 13:104127750-104127772 AATGTGGCTGAAACAGTTCCTGG + Intergenic
1114634712 14:24180866-24180888 GATGCCTGTGAATCAGTACCAGG - Intronic
1115798180 14:36961982-36962004 AATGCAGCTGAAATACTTCCAGG - Intronic
1116857140 14:49962722-49962744 CAAGCAGGTAAAACATTTCCTGG - Intergenic
1118860385 14:69658506-69658528 GTTACAGGTGAATCAGCTCCCGG + Exonic
1119615331 14:76095268-76095290 GATGCAGGTGGACCAGGGCCAGG - Intergenic
1120322801 14:82987339-82987361 GATGCCAGAGAATCAGTTCCTGG + Intergenic
1121495515 14:94389270-94389292 GATGCAGGTGAAACAGTTCCTGG - Intronic
1122003417 14:98683297-98683319 GTTGCAGGCCAAACAGCTCCAGG - Intergenic
1122914038 14:104848382-104848404 GATGCATGTTAAACAGTAGCAGG - Intergenic
1124534026 15:30528954-30528976 GATGCGGGGCAAAAAGTTCCAGG - Intergenic
1124698765 15:31892876-31892898 TATGCAGGTGGAAGAGTTTCAGG + Intergenic
1124764621 15:32478656-32478678 GATGCGGGGCAAAAAGTTCCAGG + Intergenic
1125910338 15:43432342-43432364 GTTGCTGCTGAAACAGTTTCTGG + Exonic
1130484945 15:84393685-84393707 GCTGCAGGTGACACAGGTACTGG - Intergenic
1130873569 15:87992484-87992506 TATGCGTCTGAAACAGTTCCAGG - Intronic
1132057543 15:98663565-98663587 AATGAAGGTGAAACTGTTTCAGG + Intronic
1138926049 16:61592652-61592674 CCTGCAGCTGAATCAGTTCCTGG - Intergenic
1139197369 16:64935488-64935510 GATGCAGGTAAAACAGACCTTGG + Intergenic
1139884184 16:70197086-70197108 GAGGCAGGAGACACAGCTCCAGG - Intergenic
1142125895 16:88410160-88410182 GGTGCAGGTCACACAGTTCACGG + Intergenic
1142125900 16:88410205-88410227 GGTGCAGGTCAGACAGTTCACGG + Intergenic
1142125904 16:88410250-88410272 GGTGCAGGTCACACAGTTCACGG + Intergenic
1142125927 16:88410532-88410554 GGTGCAGGTCACACAGTTCACGG + Intergenic
1142125933 16:88410609-88410631 GGTGCAGGTCACACAGTTCACGG + Intergenic
1144454103 17:15404793-15404815 GAGGAAGGAGAAACAGTTGCAGG + Intergenic
1145215927 17:21052366-21052388 AAAGCAGATGGAACAGTTCCTGG + Intergenic
1150552521 17:66223952-66223974 GATGCAGGTGAATCACTGCAGGG + Intronic
1151714236 17:75823366-75823388 GGTGCAGGTGAAGAAGCTCCAGG + Exonic
1151786351 17:76276912-76276934 GAGGGAGGTGAAACAGTATCTGG + Intronic
1153219347 18:2847805-2847827 GATGTAGGCGCACCAGTTCCTGG - Exonic
1154138487 18:11801833-11801855 GCTGCAGGTGGAGCAGGTCCCGG + Intronic
1158622069 18:59041379-59041401 GATGCTGGTGAAACTGCACCGGG - Intergenic
1159975214 18:74703086-74703108 GATGGAGGTGGAGCAGTTGCAGG + Intronic
1162466613 19:10845530-10845552 CATGCAGTTAAAACAGTTCTTGG + Intronic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
1167961723 19:53111240-53111262 GAGCCAGGTGAATCAGTTCCTGG - Intronic
1168456238 19:56510976-56510998 GAGGAAAGTGAAACAGTGCCGGG + Intronic
925955016 2:8954930-8954952 GACACAGGTGGATCAGTTCCAGG + Intronic
927441245 2:23119549-23119571 GATGCAGGTGACAGAATGCCTGG - Intergenic
931515480 2:63048533-63048555 GCTGCAGGCGAAACAGGGCCTGG + Intergenic
932580853 2:72991911-72991933 GATGCTGTTAAAACAGATCCTGG - Intronic
932724794 2:74170233-74170255 GAGGCAGGAGAATCACTTCCCGG - Intronic
934129375 2:88932838-88932860 GATGAACTTGAAACAGTTCCAGG + Intergenic
934783061 2:96985248-96985270 GATGGAGGAGAAACAGGTCCTGG - Intronic
935553718 2:104484747-104484769 GATACAGGTGAAACAGATAGGGG - Intergenic
935785262 2:106543170-106543192 GCTGCAGGTAAGGCAGTTCCCGG - Intergenic
937675320 2:124583768-124583790 GAGGAAGGTGGAGCAGTTCCAGG - Intronic
942021800 2:171873468-171873490 GATACAGGTGAAACAGCTTGAGG + Intronic
942695320 2:178636028-178636050 GATGCAGATGACACAGATGCTGG - Exonic
945719366 2:213400296-213400318 GATGCAGTTGAAACAGTATTTGG - Intronic
947622171 2:231597656-231597678 GATGAAGGTGACACAGTTTGTGG - Intergenic
1169034407 20:2437811-2437833 AAGGCACCTGAAACAGTTCCTGG - Intergenic
1169923769 20:10761684-10761706 GATCCAGGTGACAGAGTACCTGG + Intergenic
1170432894 20:16293595-16293617 GAAGCAGGCGAAACAATTCAAGG + Intronic
1171996366 20:31734779-31734801 GATGCAGGAGAATCACTTCCCGG + Intergenic
1173311342 20:41898739-41898761 TTTACAGGTGAAACAGTTCCAGG - Intergenic
1175027690 20:55919936-55919958 GATGCAGAAGAAACAGTTAAAGG - Intergenic
1175056598 20:56204423-56204445 GATGCAGGTGCAGCTGGTCCGGG - Intergenic
1177079376 21:16619720-16619742 TATCCAGGGGCAACAGTTCCAGG + Intergenic
1179089308 21:38249539-38249561 CATGGAGGTGAAACAACTCCAGG + Intronic
1179642120 21:42754539-42754561 GCAGAAGGTGACACAGTTCCCGG - Intronic
1183287401 22:36976130-36976152 CACGCAGCTGAATCAGTTCCTGG - Intergenic
1183922526 22:41180617-41180639 GAGGCAGGAGAATCAGATCCTGG + Intergenic
1184283003 22:43449604-43449626 GTGGCAGGTGGAAGAGTTCCAGG - Intronic
1184816080 22:46871674-46871696 GATGCAGCTAAAACAGTGCCTGG + Intronic
949942098 3:9163075-9163097 GATACAGGTAGAACAATTCCTGG + Intronic
950675263 3:14550704-14550726 GATGGAGGTGAAGGGGTTCCAGG - Intergenic
951956471 3:28260743-28260765 GATGCAGCTAAAACAGTACTTGG - Intronic
953719764 3:45345180-45345202 GATGCAGCTGATTCAGTTCTTGG + Intergenic
955116941 3:56015068-56015090 CATGGAGGAGAAACAGTTGCTGG - Intronic
956118184 3:65939673-65939695 GATGCAGATGACACAGTCCAGGG - Intronic
962454335 3:135551363-135551385 GATGCAGAAGAAACAGTTGTTGG + Intergenic
964680526 3:159332919-159332941 GATGCAGGAGCAACTCTTCCAGG - Intronic
964879675 3:161409761-161409783 GAAGCATTTGAAACAATTCCTGG + Intergenic
967267125 3:187700628-187700650 GATGTAGGTGAAGCAATTCTGGG - Intronic
969586270 4:8095857-8095879 GCTGCAAGCGAAACAATTCCTGG - Intronic
970880863 4:20928456-20928478 GATGCAGCAAAAACAGTTCTAGG + Intronic
973726499 4:53782277-53782299 GATTCAGGGCAAACAGATCCAGG - Intronic
973741246 4:53921486-53921508 GATGCACATGAAACAGTGGCTGG + Intronic
975168612 4:71207288-71207310 AAAGCAGATGAAACATTTCCAGG - Intronic
975361386 4:73475696-73475718 GATGCAGATGAGAAACTTCCTGG - Intergenic
977145266 4:93431846-93431868 GATGGAGTTGAATCTGTTCCAGG - Intronic
977366650 4:96077681-96077703 GTTCCAGGTGAAACAGTATCTGG - Intergenic
980240631 4:130170072-130170094 AAAGCAGTTGAAACAGTACCTGG + Intergenic
980963545 4:139499563-139499585 CATGCAGCTGAATCAGTTCCTGG - Intronic
983000594 4:162409225-162409247 GATGCAGGTGACACAGCTGTCGG + Intergenic
984351641 4:178601610-178601632 TATGAAGATGAAACAATTCCTGG - Intergenic
987413915 5:17642983-17643005 GATGTTGGGGAAACAGTACCTGG + Intergenic
989263725 5:39448263-39448285 GAAACAGGTGATTCAGTTCCTGG - Intronic
989743088 5:44794658-44794680 CATGCCTGTGAAACAGTTTCAGG - Intergenic
991057605 5:62336626-62336648 GATGCTGCTAAAACAGTTCTGGG + Intronic
992157054 5:73965975-73965997 GATGAAGTTGAAAGAGTTGCAGG - Intergenic
993548041 5:89237796-89237818 GATGAAGGTGAAACAGATTGAGG - Intergenic
994653631 5:102561851-102561873 TATGATGATGAAACAGTTCCTGG + Intergenic
995342442 5:111074437-111074459 AATGCAGTTGGAACAGTGCCTGG + Intronic
997466031 5:134088722-134088744 GATGTAGGTGGGACATTTCCAGG - Intergenic
997946624 5:138208461-138208483 AATGCAGGTGAAAGAGTTAGGGG - Intronic
997980639 5:138465680-138465702 GCTGCAGGGGACACAGTTGCGGG - Exonic
998834777 5:146192941-146192963 GATGTATGTAAAAGAGTTCCAGG + Intergenic
999644598 5:153705282-153705304 GAAGCAGGTGACCCAGGTCCCGG - Intronic
999884908 5:155911546-155911568 GAAGCAGTTCAAACACTTCCAGG - Intronic
1001642382 5:173253531-173253553 GAAGCAGGGGAAAGAGTACCCGG + Intergenic
1003382211 6:5635574-5635596 GATGCAGGTGACACATGTGCTGG + Intronic
1006152591 6:31997305-31997327 GCTGCAGGTGAACCACTCCCTGG + Exonic
1006158897 6:32030042-32030064 GCTGCAGGTGAACCACTCCCTGG + Exonic
1006487546 6:34356064-34356086 AATGCAGGACACACAGTTCCTGG + Intronic
1007448849 6:41927764-41927786 GTTGCCAGGGAAACAGTTCCAGG + Intronic
1011144323 6:84195663-84195685 CATGCAGAAGAAACAGTTACAGG - Intronic
1012094343 6:94939667-94939689 TATCCAGGTGAATCAATTCCAGG + Intergenic
1012298701 6:97557275-97557297 GATGCAGCAGAAAGAGTTTCCGG - Intergenic
1016373449 6:143397243-143397265 GATCCAGGAGAAACATTTTCTGG - Intergenic
1018925140 6:168200680-168200702 GATGCGGCTGACACAGTGCCAGG + Intergenic
1019179656 6:170178323-170178345 GATGCAGGAGAAAGAATTCTGGG + Intergenic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1021412962 7:20348895-20348917 GATGAAGGAGAAACAGTAGCTGG + Intronic
1023401655 7:39795925-39795947 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1023616175 7:42022613-42022635 GATGCAGGTGCTACAACTCCTGG - Intronic
1023997553 7:45170971-45170993 GATGCAGCTAAAACAGTACTTGG - Intronic
1029162584 7:98563249-98563271 GATGAACTTGAACCAGTTCCAGG - Intergenic
1030423072 7:109333465-109333487 GATGCCTTTCAAACAGTTCCAGG - Intergenic
1032973951 7:137200487-137200509 GAAGCTGGTGAAACAATTGCAGG + Intergenic
1033474248 7:141675271-141675293 TATGCAGGAGAATCCGTTCCAGG - Intronic
1035946261 8:3966495-3966517 GAAACAGGAGAATCAGTTCCTGG + Intronic
1038090155 8:24243852-24243874 GAAGCAGCTGAAACAGTTTGTGG + Intergenic
1041352800 8:56965739-56965761 TATGCAGGTTAAAGAGTTCAGGG + Intronic
1042568837 8:70140691-70140713 GAGGCAGGAGAATCACTTCCTGG - Intronic
1048844599 8:138594650-138594672 GATGCATGTGGAATAGTGCCTGG + Intronic
1049860553 8:144895372-144895394 GAGGCAGGTGAACCAGTCCCAGG - Intronic
1051755888 9:20399775-20399797 GAGGCATGTGAAACTGTTCGAGG + Intronic
1051811483 9:21054504-21054526 GATGATGGGGAAACAGTTCATGG + Intergenic
1053319824 9:37086825-37086847 GATGCAGATGAACCACATCCAGG + Intergenic
1053460249 9:38263228-38263250 AATGAAGATGAAACAGTTCCTGG + Intergenic
1056465159 9:86846632-86846654 GAAGCAGGAGACCCAGTTCCTGG + Intergenic
1057003373 9:91533564-91533586 GAGGCATGTCAGACAGTTCCTGG - Intergenic
1057552757 9:96064083-96064105 GCTTCGGGTGAAACAGATCCAGG - Intergenic
1061746905 9:132746743-132746765 GATCCAGGTGGAAAAGTTGCAGG + Intronic
1186709247 X:12175430-12175452 GATGCAGATGAAACAGGTCCAGG - Intronic
1187435922 X:19268891-19268913 CATACAGGTGAAGCAGTTCTTGG + Intergenic
1189393610 X:40600222-40600244 GATGCAGGTGAAGAACTTCAAGG - Intronic
1190701832 X:52995139-52995161 AATGCGGGTGAAGCAGTTTCGGG - Intronic
1190835497 X:54097121-54097143 GATCCAAGTGAAACAATTCATGG + Intronic
1192210095 X:69122291-69122313 CATGCAGGTGAAGCAGAGCCAGG - Intergenic
1195791170 X:108588195-108588217 GATGCATGTGGTACAGTGCCTGG + Intronic
1197496999 X:127196489-127196511 TATGAAGATGAAATAGTTCCCGG + Intergenic
1197551154 X:127894203-127894225 TATGAAGATGAAACAGTTCAAGG - Intergenic
1199133324 X:144220413-144220435 TATGAAGGTGAGACAGTTCTTGG - Intergenic
1199203650 X:145122976-145122998 GAAGCAGGTGGGAGAGTTCCTGG + Intergenic
1201339950 Y:12923664-12923686 GAAGTTGGAGAAACAGTTCCTGG - Intergenic
1202373162 Y:24211600-24211622 GCTGCAGGTGACACAGGTACTGG + Intergenic
1202381427 Y:24278671-24278693 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1202489358 Y:25391455-25391477 ACTGCAGGTGAAACAGATGCTGG + Intergenic
1202497620 Y:25458520-25458542 GCTGCAGGTGACACAGGTACTGG - Intergenic