ID: 1121495714

View in Genome Browser
Species Human (GRCh38)
Location 14:94390289-94390311
Sequence ACAGCTCCAGCACTGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121495708_1121495714 21 Left 1121495708 14:94390245-94390267 CCCTGAGCTGGCTGAATGGATAT 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG 0: 1
1: 0
2: 2
3: 46
4: 348
1121495705_1121495714 26 Left 1121495705 14:94390240-94390262 CCTTCCCCTGAGCTGGCTGAATG 0: 1
1: 0
2: 0
3: 22
4: 206
Right 1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG 0: 1
1: 0
2: 2
3: 46
4: 348
1121495709_1121495714 20 Left 1121495709 14:94390246-94390268 CCTGAGCTGGCTGAATGGATATT 0: 1
1: 0
2: 0
3: 4
4: 150
Right 1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG 0: 1
1: 0
2: 2
3: 46
4: 348
1121495710_1121495714 -3 Left 1121495710 14:94390269-94390291 CCGCTGCTCTACATCCACTCACA 0: 1
1: 0
2: 0
3: 24
4: 318
Right 1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG 0: 1
1: 0
2: 2
3: 46
4: 348
1121495707_1121495714 22 Left 1121495707 14:94390244-94390266 CCCCTGAGCTGGCTGAATGGATA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG 0: 1
1: 0
2: 2
3: 46
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121495714 Original CRISPR ACAGCTCCAGCACTGGGCTG TGG Intronic
900178338 1:1300485-1300507 TCAGCCCCAGAAATGGGCTGGGG - Intronic
900369233 1:2324017-2324039 CCACCTCCAGCCCTGGGCTGCGG + Intronic
900711744 1:4118938-4118960 ACACCTCCAGCACGGCTCTGGGG - Intergenic
903226192 1:21895314-21895336 ACTGGCCCAGCACTGGGATGGGG - Intronic
903302116 1:22386458-22386480 CGAGCTTCAGCACTGGGCTGGGG + Intergenic
904439236 1:30518976-30518998 CCAGCTCCACCACAGGGCTTGGG + Intergenic
904603574 1:31686574-31686596 ACAGGCGGAGCACTGGGCTGAGG + Intronic
904899687 1:33847094-33847116 CCTGCTCCAGAGCTGGGCTGAGG - Intronic
905888754 1:41506709-41506731 ACAGCAACCGCACTGGGATGGGG - Exonic
906681003 1:47725395-47725417 CCAGATCCAGCCTTGGGCTGGGG - Intergenic
906695621 1:47821433-47821455 TCAGCTACAGGACTTGGCTGTGG + Intronic
907114754 1:51958985-51959007 ACAGCTCCAGCACCAGGCACAGG - Intronic
907193245 1:52665954-52665976 AGAGCACCGGCCCTGGGCTGTGG + Intronic
907498963 1:54864686-54864708 CCAGCTCAAGCCCTGGGCTCTGG + Intronic
908185243 1:61646216-61646238 AAATCTGCAGCACTGGGCTCAGG + Intergenic
909691219 1:78409739-78409761 AGAGCTTCTGCACTGTGCTGGGG - Intronic
915597647 1:156904628-156904650 GCAGCCCCAGCGTTGGGCTGTGG + Intronic
917423769 1:174892161-174892183 CCAGCTCCAGCACTCGGGTTGGG + Intronic
917556133 1:176090555-176090577 ACAGCAGCAGCACAGGGCAGGGG + Intronic
918006590 1:180547074-180547096 ACAGATGCAGAACTGGGTTGAGG - Intergenic
918012452 1:180600698-180600720 ACACCTCCAGCGCTTAGCTGTGG - Intergenic
918623636 1:186633633-186633655 ATAGCTCCAGCACTGATCTTAGG - Intergenic
918656683 1:187035506-187035528 ACAGCCCCAGCACAGGGATTAGG - Intergenic
918684461 1:187397442-187397464 AGAGCTCAAACACTGTGCTGGGG - Intergenic
920373357 1:205493221-205493243 ACATCCCCAGGACTGGGCTAAGG + Intergenic
920970960 1:210743505-210743527 ACAGCCTGAGCAGTGGGCTGAGG + Intronic
922613280 1:226945426-226945448 ACAGAACAAACACTGGGCTGGGG - Intronic
922722125 1:227904560-227904582 ACGGCCCCAGCCCTGGACTGGGG + Intergenic
922739554 1:228007468-228007490 ACAGGGCGAGCAGTGGGCTGGGG + Intronic
923971104 1:239204251-239204273 ACAGCTCTCACACTGGGATGGGG + Intergenic
924253335 1:242157829-242157851 AAAGCTCCAACGCTGTGCTGGGG + Intronic
1064122998 10:12635472-12635494 AGAGCTCCTGCACTGCGCCGTGG - Intronic
1064944845 10:20775801-20775823 ACAGCTCCAGCACTTCAATGTGG - Intergenic
1067286164 10:44908976-44908998 ACAGGAGCAGCACTGGGCAGTGG - Intergenic
1067712219 10:48658457-48658479 ACAGCTCAAGTAGTGTGCTGAGG - Intergenic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1067945588 10:50686276-50686298 AGAGCGCGGGCACTGGGCTGAGG + Intergenic
1068010735 10:51447295-51447317 AGAGTTGCAGCACTGGGGTGGGG - Intronic
1069034260 10:63630634-63630656 ACTGCTCCAGAACTGGACCGAGG + Intergenic
1070867099 10:79713149-79713171 AGAGCGCGGGCACTGGGCTGAGG + Intronic
1070880889 10:79851270-79851292 AGAGCGCGGGCACTGGGCTGAGG + Intergenic
1071452377 10:85809922-85809944 ACAGCTCCCAGACTGAGCTGAGG - Intronic
1071634014 10:87235373-87235395 AGAGCGCGGGCACTGGGCTGAGG + Intronic
1071647460 10:87367590-87367612 AGAGCGCGGGCACTGGGCTGAGG + Intronic
1072230047 10:93407030-93407052 AAAACTCCATGACTGGGCTGTGG - Intronic
1072542723 10:96410529-96410551 GCAGCTCCCGCACGGGGCAGCGG + Intronic
1072735732 10:97878134-97878156 AGGGCTCCAGCCCTGGCCTGGGG + Intronic
1073572168 10:104589776-104589798 AGGGATCCAGCACTGGCCTGGGG - Intergenic
1074097944 10:110330419-110330441 ACTGCTCCAACCCTGGCCTGGGG - Intergenic
1075312103 10:121423054-121423076 ACAGCTCTGGCCCAGGGCTGTGG + Intergenic
1075446607 10:122517767-122517789 CCATCTAGAGCACTGGGCTGAGG + Intergenic
1075880733 10:125848580-125848602 ACAGCAACAGCACTGGACTTGGG - Intronic
1076239134 10:128890401-128890423 AGATCTTCAGCACTGTGCTGGGG + Intergenic
1076712834 10:132348021-132348043 ACAACTCCAGTCCTGGGCTCGGG - Exonic
1076869680 10:133187239-133187261 CCAGGGGCAGCACTGGGCTGGGG - Intronic
1077497141 11:2891855-2891877 CCACCTCCTGCCCTGGGCTGGGG + Intronic
1077619395 11:3706603-3706625 ACTGCTCCACCTCTGGGCTCTGG + Exonic
1077734899 11:4781091-4781113 ACAGCTCCAGCCAGGGGCTGGGG + Intronic
1078507988 11:11966260-11966282 ACAGCACCAGCAAAGGCCTGGGG + Intronic
1078604381 11:12762159-12762181 AGAGCTCAAGGACTGGCCTGTGG + Intronic
1079493356 11:21013438-21013460 AGAGCTGCAGCACTGGGCTATGG + Intronic
1080891269 11:36410883-36410905 CCAGCTACAGCACTGGGCACAGG + Intronic
1082946642 11:58768460-58768482 ACAGGTCAAGAGCTGGGCTGTGG + Intergenic
1083365908 11:62141328-62141350 ACACCTCCACCACTGGGGTGAGG + Intronic
1083775853 11:64894079-64894101 CCAGCTCCAGCACTTGGAGGGGG - Intergenic
1084723893 11:70927887-70927909 TCAGCTCCAGCAGTCAGCTGGGG - Intronic
1086405783 11:86497935-86497957 AGAGCTCCTGCCCTGGGCAGTGG + Intronic
1087715342 11:101602310-101602332 ATATCTCAAGCACTGGGCTTAGG - Intronic
1088326816 11:108609187-108609209 ACAGCTCCAGGGATGGGTTGGGG + Intergenic
1089294534 11:117459750-117459772 ACAGGTCCAGCAACGGGCTGAGG + Intronic
1090657494 11:128857114-128857136 GCAGCTCCTGCCCTGGGCTTCGG + Intronic
1091330095 11:134725331-134725353 GCAGCACCAGCACCGGCCTGCGG - Intergenic
1091410710 12:237427-237449 CCACCTCCAGCTCTGGGCTAAGG - Intronic
1091589186 12:1833412-1833434 ACAGATGCAGGACAGGGCTGGGG - Intronic
1091600875 12:1916978-1917000 CCAACTCCAGGAGTGGGCTGAGG - Intronic
1091695036 12:2622697-2622719 CTAGCTTCAGCATTGGGCTGGGG - Intronic
1092811576 12:12275848-12275870 ACTGCTGCTGCACTGGGCAGGGG - Intergenic
1094202526 12:27808442-27808464 ACATGTCCAGCCCTAGGCTGGGG + Intergenic
1094498315 12:31002910-31002932 ACCGCTCCAGCTGCGGGCTGTGG + Intergenic
1096052366 12:48622355-48622377 ACAGCACAGGCTCTGGGCTGGGG - Intergenic
1097226146 12:57477781-57477803 TCACCGCCAGCTCTGGGCTGAGG + Intronic
1099490026 12:83276749-83276771 AGAGCTCAAACACTGTGCTGGGG + Intergenic
1099816904 12:87661025-87661047 ACACCTCCCACACTGGCCTGTGG + Intergenic
1100420604 12:94429432-94429454 ATAGCTGCAGGACTGGGATGGGG - Intronic
1100853622 12:98739106-98739128 CCAGCTCCACCACTTGGCTGTGG - Intronic
1100879940 12:99005235-99005257 GCAGTCCCAGCACTGGGCTGTGG - Intronic
1101282955 12:103278539-103278561 TCCACTCCTGCACTGGGCTGTGG + Intronic
1101442791 12:104716016-104716038 TCAGCTCCAGCCCAGGCCTGGGG + Intronic
1101727228 12:107398144-107398166 ACAGCTCTGGCATTGGGTTGGGG + Intronic
1101897900 12:108769740-108769762 ACAGCCCCAGCTGGGGGCTGTGG - Intergenic
1102629622 12:114266505-114266527 CCATCTCCAGCAGTTGGCTGAGG + Intergenic
1103878712 12:124149415-124149437 ACAGGTCCAGCACTTGGCTTTGG + Intronic
1105019505 12:132806536-132806558 GCAGCTCCAGCCCTGCTCTGCGG + Intronic
1106251701 13:27986929-27986951 TCAGCTCCTCCACTGGGCTTGGG - Intronic
1106421219 13:29587836-29587858 ACAGCCCCAGGACTTGGCTGCGG + Intronic
1107735883 13:43398167-43398189 TATGCTCCAGCACTGTGCTGTGG - Intronic
1108113432 13:47102343-47102365 ACAACTCCAGCCATGGGCTCAGG + Intergenic
1111314543 13:86535782-86535804 ATAACTCCAGCACTGAGTTGTGG - Intergenic
1111628008 13:90813824-90813846 AGAGCTCAAGCACTGTGCTGAGG - Intergenic
1113821816 13:113219930-113219952 ACAGCTACAGTACTGGGAGGAGG - Intronic
1113904623 13:113813448-113813470 CCAGATCCAGGACTGGGCAGGGG - Exonic
1113910080 13:113837576-113837598 CCAGCTCTGGCCCTGGGCTGAGG + Intronic
1115549101 14:34489114-34489136 ACATTTCCAGCTCTAGGCTGGGG - Intergenic
1116791751 14:49346752-49346774 CTAGCTCCAGCACTGGGCTGAGG + Intergenic
1118516028 14:66529961-66529983 AGAGCTCAAGCACTGTGCTGGGG + Intronic
1119436080 14:74598730-74598752 TCAGCTCCACCACGTGGCTGAGG - Intronic
1120722512 14:87904241-87904263 ACACACCCATCACTGGGCTGGGG + Intronic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1122202017 14:100128472-100128494 CCAGCTCCAGCACCCAGCTGGGG - Intronic
1122258694 14:100499750-100499772 AGAGCTCCTGTCCTGGGCTGTGG + Intronic
1122362234 14:101174330-101174352 GGAGCTTGAGCACTGGGCTGGGG - Intergenic
1122388225 14:101363117-101363139 ACTGCTCTGGCACTGGCCTGGGG - Intergenic
1122719280 14:103713126-103713148 ACAGCTCCAGAGCTGGGCAGGGG - Intronic
1122980639 14:105191018-105191040 ACAGCTCCAGCAGGAGGGTGGGG - Intergenic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1123017859 14:105384141-105384163 GGAGCTCCAGCCCTGAGCTGAGG - Intronic
1123042584 14:105496464-105496486 GGGGCTCCAGCAGTGGGCTGGGG - Intronic
1123945717 15:25237911-25237933 TCAGCTCCTGCACTGAGCTGGGG + Intergenic
1124559631 15:30759532-30759554 ACAGCTCATCCACAGGGCTGGGG - Intronic
1124671620 15:31646174-31646196 ACAGCTCATCCACAGGGCTGGGG + Intronic
1125608602 15:40956288-40956310 TCAGCTCCAGCTCTGCTCTGGGG - Exonic
1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG + Exonic
1127273709 15:57423921-57423943 GGAGCTCCAGCACCGAGCTGCGG - Intronic
1127336684 15:57993018-57993040 ATAGCTCCAGCTTTGTGCTGTGG - Exonic
1127659459 15:61086260-61086282 AGAGCAAAAGCACTGGGCTGGGG + Intronic
1127858042 15:62968544-62968566 AAAGCTGCAACACTGAGCTGTGG + Intergenic
1127991590 15:64122710-64122732 ACAGCTCCAGTGCTGGACTATGG - Intronic
1129321737 15:74778804-74778826 ACTCCTCCAACACTGGCCTGGGG + Intergenic
1130204253 15:81861457-81861479 ACAAACCCAGCCCTGGGCTGGGG - Intergenic
1131524185 15:93139593-93139615 TCAGCTCTGGCACTGGGCTTGGG - Intergenic
1131783371 15:95884006-95884028 ACAGCTGCAGAACTGGGCTCTGG + Intergenic
1132311604 15:100861766-100861788 ACAGCTCTTGCACAGGGCAGTGG - Intergenic
1132658031 16:1049401-1049423 ACAGAGCCAGCACTGGGGGGTGG + Intergenic
1132722443 16:1323396-1323418 CCATCTCCAGAGCTGGGCTGTGG + Intronic
1135699321 16:24617822-24617844 ACATCTCCAGAACTGTGCAGGGG - Intergenic
1135996987 16:27257740-27257762 ACAGCATCAGGACTGGGCAGTGG + Intronic
1136037237 16:27549662-27549684 ACAGCTCCAGGACCGGTCAGCGG - Exonic
1136136457 16:28259371-28259393 GCAGCTCCAGGACAGGGCAGGGG - Intergenic
1136183929 16:28573949-28573971 ACAGCCCCACCACTGGACAGGGG - Intronic
1137561830 16:49507492-49507514 ACAGCTGCAGCCCTGACCTGTGG - Intronic
1138562575 16:57810677-57810699 TCAACTTCAGCAATGGGCTGAGG + Intronic
1138923083 16:61556314-61556336 AACGCTGCTGCACTGGGCTGTGG - Intergenic
1139367304 16:66441405-66441427 ACAGCTCCAGATCTGGAATGAGG - Intronic
1142207256 16:88789753-88789775 ACCGCGCCAGCACGGGGCTGGGG + Intergenic
1142252859 16:89000706-89000728 ACACCTCCGTCCCTGGGCTGGGG + Intergenic
1142560206 17:805122-805144 AGAGCTCCAGCACGGGCTTGGGG + Exonic
1142896359 17:2981538-2981560 CCACCTCCAGCACTGGCCTCAGG - Intronic
1143614829 17:8043546-8043568 ACCAGTCAAGCACTGGGCTGAGG - Intronic
1144835719 17:18155680-18155702 ACAGCAGCAGCACTGTGCAGAGG + Intronic
1145259882 17:21348438-21348460 ACAGCTACAGCAAGGGGCGGTGG - Intergenic
1145316734 17:21739500-21739522 ACAGCTACAGCAAGGGGCGGTGG + Intergenic
1145829797 17:27906801-27906823 CCAGCTCCTGCGCTGGGCTTTGG + Intergenic
1145988374 17:29062625-29062647 TCAGCTCCAGCACAGCACTGAGG + Intergenic
1146137335 17:30334484-30334506 ACAGCTTATGCACTGGGCTTGGG - Intergenic
1147717560 17:42518676-42518698 CCAGCTCCAGCACTTGGCAAAGG - Intronic
1148468106 17:47877114-47877136 ACAGCTACATCACTGGGAAGGGG - Intergenic
1150440613 17:65188349-65188371 ACAGCTTCAGCAAGGGGATGGGG + Intronic
1150484730 17:65535947-65535969 TCAGCCCCAGCAAAGGGCTGAGG + Intronic
1150641222 17:66951089-66951111 ACAGCACCACCATTGGCCTGTGG - Intergenic
1151723882 17:75873844-75873866 GCAGGTCCAGAACTAGGCTGCGG + Intergenic
1152191717 17:78892167-78892189 CCAGCTCCAGCGCTTGGCTGAGG - Exonic
1152336800 17:79703360-79703382 ACAACTCCAGCAGTGCCCTGGGG + Intergenic
1152572515 17:81127017-81127039 GCAGCTCCTGCACTGAGCCGAGG - Intronic
1152903720 17:82959496-82959518 ACAGCTCCTGCAGACGGCTGCGG + Intronic
1152960726 18:79042-79064 TCAGGGACAGCACTGGGCTGAGG - Intergenic
1155382966 18:25244809-25244831 ACATCCCCAGCAATGGGGTGAGG - Intronic
1156522553 18:37734100-37734122 AGAGATGCAGCACTGGGCTGTGG + Intergenic
1157675096 18:49562675-49562697 ACAGCACCAGCACTGGCTTAGGG - Intronic
1158422403 18:57306840-57306862 ACCTCTCCAGCACTGAGTTGGGG + Intergenic
1159919310 18:74213377-74213399 ACAGCCTCAGCACTGTGCTTAGG - Intergenic
1160203828 18:76816783-76816805 TCTGCTCCTGCACTGGGCTATGG + Exonic
1160438174 18:78867168-78867190 CCAGCTCCACCACTGGGCGTGGG + Intergenic
1160559008 18:79744836-79744858 AGAGCTTCAGGACTGGTCTGTGG - Intronic
1160965233 19:1744517-1744539 CCAGCAGCAGCACCGGGCTGTGG + Intergenic
1161266972 19:3368643-3368665 CCAGCTCCACTACAGGGCTGGGG - Intronic
1161290604 19:3491737-3491759 ACAGCTGCAGCACGAGGCGGCGG - Exonic
1161360903 19:3849163-3849185 GCAGCACCAGCAGAGGGCTGTGG + Intronic
1161682343 19:5686582-5686604 ACAGGACCAGAATTGGGCTGTGG + Intronic
1161719847 19:5896702-5896724 ACAGCTCCAGGACTGGGGCCAGG - Intronic
1161745661 19:6058162-6058184 ACGGATCCATCTCTGGGCTGGGG + Intronic
1162419521 19:10558135-10558157 TCAGCTGGGGCACTGGGCTGGGG - Intronic
1162523487 19:11194922-11194944 CCAGCTCCGGGCCTGGGCTGAGG - Intronic
1162805338 19:13135393-13135415 GCAGCTCCACCACGGCGCTGCGG - Exonic
1163389909 19:17024427-17024449 CCAGCTCCAGCACTGGAATGTGG + Intronic
1163582933 19:18149126-18149148 ACAGCTCCACTTCTGGGCTGGGG + Intronic
1163797492 19:19345900-19345922 AATGGTCCAGCCCTGGGCTGGGG - Intronic
1163886109 19:19966271-19966293 ACAGCTCCAGCCAGGGGCTCAGG - Intergenic
1163888358 19:19989207-19989229 ACAGCTCCAGCCAGGGGCTCAGG + Intergenic
1164669872 19:30066447-30066469 CCAGCTCCTGCACCGGGGTGAGG - Intergenic
1164853165 19:31501205-31501227 ACAGCACCAACACATGGCTGAGG - Intergenic
1165091350 19:33389807-33389829 GCAGCTGCGCCACTGGGCTGAGG - Intronic
1165123882 19:33580647-33580669 ACATCTCCAACAAGGGGCTGGGG + Intergenic
1166100611 19:40569529-40569551 ACAGCTGCAGAAGTGGGCAGGGG + Intronic
1166994664 19:46714416-46714438 CCAGGCCCAGCACTGGGGTGGGG + Intronic
1167273203 19:48518207-48518229 ACAGCCCCAGCAGTGGGCAGAGG + Intergenic
1167326941 19:48832491-48832513 ACAGTTTCAGCACAGGCCTGGGG + Intronic
1168323120 19:55521970-55521992 CCAGGGCCAGCACTGGGCGGGGG - Intergenic
1168531199 19:57130871-57130893 ACAGCTCCAGCAGTGTATTGAGG + Exonic
924967677 2:92915-92937 AGAGCTCAAGCGCTGTGCTGGGG - Intergenic
925324683 2:3008737-3008759 AGAGCTGCAGAACGGGGCTGGGG + Intergenic
925752767 2:7104695-7104717 AGAGCTCAAGCACTGTGCTGGGG + Intergenic
925842901 2:8009184-8009206 TCAGCTCCAGCCCTGTGCTGAGG - Intergenic
926304068 2:11625197-11625219 ACAGCTCCAGGTCTGGCCAGGGG - Exonic
927711421 2:25328674-25328696 ACATCCCCAGCACAGTGCTGCGG + Intronic
928632539 2:33208669-33208691 AAAGCTCCAGGGCAGGGCTGAGG - Intronic
928997746 2:37312604-37312626 ACTGCTTCAGCACTGTGCTTGGG - Intronic
929998706 2:46846793-46846815 GCAGCCCCAGCCCTGGGCTCAGG + Intronic
931212798 2:60213760-60213782 AGAGCTCCAGAGCTGGCCTGAGG + Intergenic
932793436 2:74675015-74675037 ACCTCTCCAGGTCTGGGCTGGGG - Exonic
937836851 2:126479832-126479854 ACCACTCCACCACTGGTCTGTGG + Intergenic
938066181 2:128283171-128283193 ACTGCCCCAGCACTGTGTTGGGG - Intronic
938745573 2:134275116-134275138 CCAGCTCCACCCCTGGGCAGTGG + Intronic
942326131 2:174778545-174778567 ACAGCACCATCACTGGGGCGAGG - Intergenic
942448437 2:176093251-176093273 AGCGCTCCAGCGCTGGGCTACGG + Exonic
943950001 2:194121339-194121361 ACAGCTCCTGCAGTGTGCTGCGG - Intergenic
944773033 2:202933109-202933131 ACTGCTTCAGCTCTGGCCTGAGG + Intronic
945067179 2:205957228-205957250 ACACCTGCAGGGCTGGGCTGGGG - Intergenic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
946397619 2:219451281-219451303 TGAGCTCCAGCACTGGGCCAAGG + Intronic
947421105 2:229942248-229942270 GGAGCTCCAGCACAGGGTTGTGG - Intronic
948632816 2:239312907-239312929 ACCGCTCCAGCTCTGCACTGTGG + Intronic
948785459 2:240350130-240350152 ACACCACCAGCTCTGGGCTTTGG + Intergenic
948857717 2:240737953-240737975 AGAGTTCCAGCAATGGGATGGGG - Intronic
1169715273 20:8609369-8609391 AATGCTCCAGCACTTGGATGAGG + Intronic
1169863817 20:10178830-10178852 ACAGCACAAGCTCTGGGCTCTGG - Intergenic
1169980599 20:11379868-11379890 ACAGCTGCAGTGTTGGGCTGTGG - Intergenic
1170167837 20:13380590-13380612 AGAGCTCAAGCACTGTGCTGGGG + Intergenic
1171971765 20:31569314-31569336 GCAGCTCCAGGACAGGGCAGGGG + Exonic
1172428426 20:34871943-34871965 ACAATTCCAGCAGAGGGCTGAGG + Intronic
1173503852 20:43571949-43571971 ACAGCTGCTGCCCTGGGGTGTGG + Intronic
1173564403 20:44028722-44028744 ACAGCACCAGGACTGGGAGGGGG - Intronic
1173898454 20:46568874-46568896 ACAGCTCCAGCGCTGGAGGGAGG + Intronic
1174085862 20:48006765-48006787 ACCCCTCCAGCCCTGGGCTCTGG - Intergenic
1174115574 20:48224440-48224462 GCTGACCCAGCACTGGGCTGGGG - Intergenic
1174541670 20:51294590-51294612 CCTGCTCCAGCCCTGGGCTTGGG + Intergenic
1174824174 20:53754510-53754532 GCAGCTCCTGCCCTGGGCTGTGG - Intergenic
1174898546 20:54475500-54475522 CGAGTCCCAGCACTGGGCTGCGG - Intergenic
1176171479 20:63698264-63698286 TCAGCTCCTGCAGTGGGGTGGGG - Exonic
1179154480 21:38838231-38838253 ACAGCTCCAGCAATGCGCCGTGG - Intergenic
1179905773 21:44422264-44422286 AAAGCTCCAGCCCTGCCCTGTGG - Intronic
1179938276 21:44619141-44619163 ACGCCTTCAGCACTCGGCTGGGG - Intronic
1180975468 22:19845558-19845580 CCACCCCCAGCACAGGGCTGGGG - Intronic
1181907785 22:26213010-26213032 ACATATCTAGCACTGGGCTTTGG - Intronic
1182413383 22:30205533-30205555 ACAGCCCCAGCACAGAGCTGGGG + Intergenic
1183475045 22:38031518-38031540 CCAGGTCCTGCACTGGGCTCTGG - Intronic
1183650123 22:39148930-39148952 ACAGCAGCAGCTCTGGGCAGAGG + Intronic
1184258768 22:43302553-43302575 ACAGCTACTGCCCTGGGCTGAGG - Intronic
1184570324 22:45319487-45319509 ACAGCTCAGGCTCTGGCCTGTGG - Intronic
1185107723 22:48883749-48883771 CCAGCTCCGTCACTGGGCAGTGG + Intergenic
1185408725 22:50672115-50672137 ACAGCCCCAGTGCTGGCCTGGGG + Intergenic
951853042 3:27164264-27164286 ACAGCCCCAGGGCTGAGCTGAGG + Intronic
954865172 3:53722837-53722859 AATGCTCCAGCACTGGGGTGTGG + Intronic
954951443 3:54477817-54477839 ACTGCTCCAGCCATGGACTGAGG - Intronic
955887805 3:63619216-63619238 ACATCTCAAGCAGTGGGCTGGGG + Intergenic
956166874 3:66403896-66403918 AGAGCTCCAGGCCTGGGATGTGG - Intronic
956383007 3:68685968-68685990 AGAGCTCAAGCACTGTGCTGGGG + Intergenic
959791603 3:110368340-110368362 ACAGCCATAGCACTTGGCTGTGG - Intergenic
960289757 3:115869429-115869451 ATATGTCCAGCACTAGGCTGGGG + Intronic
960989437 3:123301249-123301271 ACGGCTTCTGCCCTGGGCTGGGG + Intronic
961779222 3:129311860-129311882 TCAGCTCCTACAGTGGGCTGGGG - Intergenic
966882843 3:184359758-184359780 GCAGCTCCAGAATGGGGCTGAGG - Intronic
967888105 3:194346791-194346813 ACTGCTTCAGCACAGAGCTGGGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969055062 4:4396504-4396526 TCACCGCCAGCACAGGGCTGGGG + Intronic
969612543 4:8235465-8235487 ACAGCTCCAGCCCCAGGTTGGGG - Exonic
976332405 4:83847413-83847435 TCAGGTTCAGCACTGGACTGTGG + Intergenic
977905056 4:102467735-102467757 ACAGCTCAAGCACTCTGGTGAGG - Intergenic
981286113 4:143020669-143020691 GCAGCTTCAGCTCTGGCCTGAGG + Intergenic
983587873 4:169375388-169375410 ACAGCTTCTGCTCTGGCCTGAGG - Intergenic
984843622 4:184091496-184091518 TCAGCTCCATCAGTGGGGTGTGG + Intronic
984885578 4:184446414-184446436 CCAGCCCCTGCACAGGGCTGTGG - Intronic
985817170 5:2135617-2135639 CCAGGCCCAGCACTGTGCTGAGG + Intergenic
987017841 5:13838269-13838291 TCAGCTCCAATACTGGTCTGTGG - Intronic
988615661 5:32772372-32772394 TCAGCGCCAGGACTGGACTGTGG + Intronic
989194857 5:38706847-38706869 ACAGCTCCAGCACTTGTTAGCGG + Intergenic
990361069 5:55020595-55020617 ACAGCCCCAGCTCTGAGTTGAGG + Intronic
991110686 5:62896348-62896370 AGAGCTCCAGTGCTGTGCTGGGG + Intergenic
991226979 5:64285113-64285135 CAAGCTCCAGCTCTGGGGTGGGG + Intronic
991242385 5:64474681-64474703 AGAGCTCGAGCACTGTGCTGGGG - Intergenic
992650554 5:78855379-78855401 ACTGCTTCAGCTCTGGCCTGAGG + Intronic
997349654 5:133221484-133221506 ACAGCTACAGCCCTGGGCCGGGG - Intronic
997529795 5:134574951-134574973 ACATCTCAGGCACTTGGCTGTGG + Intronic
997655091 5:135548627-135548649 CCAGCTCCAGCAAGGTGCTGGGG + Intergenic
998257497 5:140599611-140599633 ACAGCTCCAGCCAGGTGCTGTGG + Intergenic
1000770825 5:165351499-165351521 ACAGCTTCATCACTGGCCTGAGG + Intergenic
1001761612 5:174212327-174212349 TCAGTTCCAGCCCTGGGCTCCGG + Intronic
1002019680 5:176355087-176355109 ACAGTTCAAGCACTGGGTAGGGG + Intronic
1002505399 5:179675865-179675887 ACAGGGCCCGCACTGGGCTGTGG + Intergenic
1005477268 6:26219984-26220006 ACAGCTCCATCTCTGGAATGGGG - Intergenic
1006401335 6:33819413-33819435 CCAGGTCCAGCACGGGGGTGGGG - Intergenic
1006437705 6:34034884-34034906 CCAGCACCAGGACTGGGATGTGG + Intronic
1006531485 6:34658836-34658858 TCAGCTCCAACTCTTGGCTGTGG + Intronic
1006602405 6:35234845-35234867 CCTGTTCCACCACTGGGCTGTGG + Intronic
1007416517 6:41694405-41694427 ACAGCTCCAGCGGTGGGGTTGGG - Intronic
1007940228 6:45773702-45773724 ACAGCCACAGCTTTGGGCTGGGG + Intergenic
1010069011 6:71721186-71721208 ATACCTCCATCACTGGGGTGAGG - Intergenic
1010994068 6:82512905-82512927 AGAGCTTGAGCACTGTGCTGGGG - Intergenic
1015773364 6:136791462-136791484 AGGGCTCCAGCGCTGGGCGGTGG + Intronic
1016566315 6:145458758-145458780 ACAGCAACAGAACTGGGCGGGGG - Intergenic
1017035651 6:150264705-150264727 ACAGTTCCACCACAGGACTGAGG + Intergenic
1018753487 6:166828171-166828193 CCAGCTTCAGCACAGTGCTGTGG + Intronic
1018828874 6:167426864-167426886 AAAGCTTCAGCACTGGTCAGAGG + Intergenic
1018999451 6:168736644-168736666 ACAGCTGCAGCTCAGGGCGGGGG + Intergenic
1019144646 6:169968956-169968978 TCAGCTCCAGCTCTGGGCTCTGG + Intergenic
1019417724 7:935042-935064 ACACCTGGAGCACTGGGCTCAGG - Intronic
1019630110 7:2044566-2044588 ACAGAACCAGCACGGGGGTGCGG + Intronic
1020139974 7:5606743-5606765 ACACTCCCAGCACTGAGCTGGGG - Intergenic
1023264542 7:38392097-38392119 GCAGCCCCAGCTTTGGGCTGGGG - Intronic
1023841680 7:44101809-44101831 ACTGCGGCAGGACTGGGCTGGGG - Intergenic
1023993721 7:45146113-45146135 ATCGCTCCAGCACTGGTCTGGGG + Intergenic
1024063305 7:45714467-45714489 GCGGCTCCAGCCCTGGGCAGCGG + Exonic
1024581126 7:50801970-50801992 GCAGCTCCAGAAATGGGCGGTGG + Intergenic
1024894509 7:54242257-54242279 ACAGTTCCACCACGTGGCTGGGG - Intergenic
1026339379 7:69422208-69422230 ACAGCTCCCAGGCTGGGCTGGGG + Intergenic
1028641138 7:93043497-93043519 CCGGCTCCGGCGCTGGGCTGCGG - Intergenic
1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG + Intronic
1029577126 7:101411125-101411147 ACAGCAGCTGCTCTGGGCTGTGG - Intronic
1031031857 7:116743661-116743683 AGAGCTAGAGCACTGTGCTGGGG - Intronic
1031554497 7:123155913-123155935 CCAGATCCAGTTCTGGGCTGGGG - Intronic
1031958649 7:127968791-127968813 ACATCTCCTGAACTGGGCTGTGG + Intronic
1032773929 7:135090523-135090545 ACTGCTACAGCTCAGGGCTGGGG + Intronic
1032799262 7:135305472-135305494 GCAGCTCCAGGGCTGGGCAGTGG + Intergenic
1033225738 7:139560806-139560828 ACAGCGCCTGGACGGGGCTGTGG + Intergenic
1033813588 7:145046464-145046486 ACAGAACCAGCACTGTGCTGGGG + Intergenic
1034324771 7:150220486-150220508 CCTTCTCCAGCTCTGGGCTGCGG - Intergenic
1034553970 7:151838219-151838241 ACTGCTGCAGCACTCAGCTGGGG + Intronic
1034768420 7:153748745-153748767 CCTTCTCCAGCTCTGGGCTGCGG + Intergenic
1035101415 7:156400548-156400570 ACACCTGCCTCACTGGGCTGAGG + Intergenic
1035400961 7:158565388-158565410 ACAGAGCCAGCTCTGGGCTGTGG + Intronic
1038310330 8:26441336-26441358 ACAGCCCCAGCCCCGGGCTCAGG - Intronic
1038982703 8:32776949-32776971 ATAGCCCCAGCACTGGGAAGTGG + Intergenic
1039832409 8:41225622-41225644 AGAGCTCAAGCGCTGTGCTGGGG - Intergenic
1039880379 8:41621852-41621874 AGAGCTGCTGCACTGGGCTTTGG + Exonic
1040462468 8:47662091-47662113 AGAGCGCCTGCACTGGCCTGAGG - Intronic
1041348292 8:56923833-56923855 TCAGCCCAAGCACTGTGCTGTGG + Intergenic
1043077037 8:75715509-75715531 CCTGCTCCAGCACAGGGCTCTGG - Intergenic
1045311632 8:101008207-101008229 ACAGGTCAGTCACTGGGCTGGGG - Intergenic
1047252947 8:123194264-123194286 GCAGCTCCAGCTCCGGGCAGAGG - Intronic
1048292612 8:133192088-133192110 GCAGGTCCTGCCCTGGGCTGTGG - Intronic
1048969889 8:139639573-139639595 AGACCCCCAGCGCTGGGCTGGGG - Intronic
1049397276 8:142406859-142406881 ACAGCCCCAGCACAGGACAGTGG + Intergenic
1049478581 8:142808234-142808256 GCAGCAGCAGCAGTGGGCTGGGG + Intergenic
1050564654 9:6869593-6869615 TCAGCTCCAGCACTGCCCTTAGG - Intronic
1051366198 9:16323168-16323190 ACTGGAGCAGCACTGGGCTGAGG + Intergenic
1053139352 9:35673075-35673097 ATAGGTCCAGCACTGGGCTATGG - Intronic
1053549395 9:39060024-39060046 CCAGGTCCAGCACTGGCCTAAGG - Intergenic
1053813510 9:41880098-41880120 CCAGGTCCAGCACTGGCCTAAGG - Intergenic
1054617086 9:67307341-67307363 CCAGGTCCAGCACTGGCCTAAGG + Intergenic
1054748541 9:68880843-68880865 ACACCTGCAGCACAGGACTGAGG + Intronic
1055614028 9:78052862-78052884 ACAGTTTCAGCTCTGAGCTGAGG + Intergenic
1056571546 9:87820939-87820961 ACACCTCCAGCACGGCTCTGGGG + Intergenic
1056684736 9:88750258-88750280 CCAGCTCCAGCAATGGCCAGTGG + Intergenic
1056997719 9:91479159-91479181 AGAGCTTGAGCACTGTGCTGGGG + Intergenic
1057204530 9:93163331-93163353 ACAGCCCCAGCACTCGTCTTGGG + Intergenic
1057228981 9:93307630-93307652 CCAGCTCCTGCCATGGGCTGCGG - Intronic
1057353342 9:94317780-94317802 AGAGCACGGGCACTGGGCTGAGG - Intergenic
1057654409 9:96939812-96939834 AGAGCACGGGCACTGGGCTGAGG + Intronic
1059061036 9:111036176-111036198 ACAGCTCCTGCCCAGGTCTGTGG - Intronic
1059301420 9:113316769-113316791 GCAGTTCCAGCCCTTGGCTGTGG + Exonic
1059326181 9:113505253-113505275 ACAACTTGAGCACTGGGTTGTGG - Intronic
1060123908 9:121023769-121023791 AGAGCTACAGGACTGGACTGAGG + Intronic
1060147822 9:121267851-121267873 GCAGCTCCTGAGCTGGGCTGGGG - Intronic
1060321699 9:122567913-122567935 ACAATTTCAGCACAGGGCTGAGG + Exonic
1060426579 9:123511487-123511509 TCATCCCCAGCACAGGGCTGAGG + Intronic
1060735887 9:126066374-126066396 CCTGTTCCAGCACTGGGGTGGGG - Intergenic
1060740168 9:126092585-126092607 CCAGCCCCAGCACTGCTCTGTGG - Intergenic
1060806863 9:126583219-126583241 ACAGATCCAGCGGTGGGCAGAGG + Intergenic
1061369785 9:130191843-130191865 ACTGGTCCAGCACTGGGCTGGGG - Intronic
1061418424 9:130460674-130460696 ATAGGGCCAGGACTGGGCTGAGG + Intronic
1062056888 9:134473484-134473506 ACCGCCCTAGCACAGGGCTGTGG + Intergenic
1062201005 9:135302610-135302632 CCAGCTCCAGGACTGGTGTGAGG - Intergenic
1062219123 9:135404825-135404847 ACAGGTCCAGGCCTGGGCTTAGG - Intergenic
1062737369 9:138144705-138144727 TCAGGGACAGCACTGGGCTGAGG + Intergenic
1185484362 X:470997-471019 TCACCTCCAGCTCTGGGCTAAGG - Intergenic
1186371280 X:8949792-8949814 GAATCTTCAGCACTGGGCTGGGG - Intergenic
1187818754 X:23262341-23262363 ATAGCTCCAGGACTAGGATGAGG - Intergenic
1188237946 X:27752114-27752136 CCATCTCCAGGGCTGGGCTGAGG - Intergenic
1189092001 X:38093432-38093454 ACCTTTCCAGAACTGGGCTGAGG - Intronic
1189712337 X:43826454-43826476 GCATCTCCAGCACTTGGCTCAGG - Intronic
1190149878 X:47936646-47936668 ACAGCTCAGGCACTGAGCTGGGG + Intronic
1191208152 X:57855611-57855633 AGAGCTCGAGCACTGTGCTGGGG - Intergenic
1191258921 X:58292097-58292119 ACAGCCTCTGCACTGGGCTAGGG + Intergenic
1191714259 X:64183498-64183520 TCAGCTCCAGCACTGTTCTATGG - Intergenic
1191877313 X:65809781-65809803 AGAGCTGCTGCACTGTGCTGGGG - Intergenic
1192009313 X:67250823-67250845 AGAACTCCAGCTCTGTGCTGGGG - Intergenic
1192228515 X:69246535-69246557 AGAGCTCGAGCATTGTGCTGGGG - Intergenic
1193542493 X:82788917-82788939 AGAGCTCGAACACTGTGCTGGGG - Intergenic
1194133129 X:90106434-90106456 ACAGCTCCAGCTAGGGGCTCAGG - Intergenic
1194930527 X:99881637-99881659 AAGGCTACAGAACTGGGCTGAGG + Intergenic
1195478802 X:105319116-105319138 AAAGCTCCTTTACTGGGCTGTGG - Intronic
1195533349 X:105982542-105982564 ATAGCTCCTGCACTGGTCAGTGG - Intergenic
1196167950 X:112555751-112555773 ACAGCTGCTGTACTGTGCTGTGG - Intergenic
1198325979 X:135573503-135573525 TCCGCTGCAGCACTGAGCTGAGG - Intronic
1200280880 X:154775943-154775965 ACAGCAGCAGCACGGGGCTTGGG - Intronic
1200365353 X:155657114-155657136 AGAGCTCGAGCACTGTGCTGGGG + Intronic
1200478916 Y:3676509-3676531 ACAGCTCCAGCTAGGGGCTCAGG - Intergenic
1201692941 Y:16789464-16789486 GAAGCTCGAGCACTGTGCTGGGG - Intergenic