ID: 1121497419

View in Genome Browser
Species Human (GRCh38)
Location 14:94403555-94403577
Sequence GAGCCCACTGTTCTTTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121497419_1121497421 17 Left 1121497419 14:94403555-94403577 CCCATGAAAAGAACAGTGGGCTC No data
Right 1121497421 14:94403595-94403617 AATTACATTATCAGTACATACGG No data
1121497419_1121497422 18 Left 1121497419 14:94403555-94403577 CCCATGAAAAGAACAGTGGGCTC No data
Right 1121497422 14:94403596-94403618 ATTACATTATCAGTACATACGGG No data
1121497419_1121497424 25 Left 1121497419 14:94403555-94403577 CCCATGAAAAGAACAGTGGGCTC No data
Right 1121497424 14:94403603-94403625 TATCAGTACATACGGGGAAAAGG No data
1121497419_1121497423 19 Left 1121497419 14:94403555-94403577 CCCATGAAAAGAACAGTGGGCTC No data
Right 1121497423 14:94403597-94403619 TTACATTATCAGTACATACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121497419 Original CRISPR GAGCCCACTGTTCTTTTCAT GGG (reversed) Intergenic
No off target data available for this crispr