ID: 1121499770

View in Genome Browser
Species Human (GRCh38)
Location 14:94425459-94425481
Sequence GTAGGTTATCAGTAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121499765_1121499770 17 Left 1121499765 14:94425419-94425441 CCATCTTAGATTATATTCAGAAG No data
Right 1121499770 14:94425459-94425481 GTAGGTTATCAGTAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121499770 Original CRISPR GTAGGTTATCAGTAGATGGA GGG Intergenic
No off target data available for this crispr