ID: 1121501184

View in Genome Browser
Species Human (GRCh38)
Location 14:94439645-94439667
Sequence AAAATCCCCCCAGTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121501184_1121501192 13 Left 1121501184 14:94439645-94439667 CCAGTGACCACTGGGGGGATTTT No data
Right 1121501192 14:94439681-94439703 ACGGAACTCTGCTCTGTGGGAGG No data
1121501184_1121501190 9 Left 1121501184 14:94439645-94439667 CCAGTGACCACTGGGGGGATTTT No data
Right 1121501190 14:94439677-94439699 TGGTACGGAACTCTGCTCTGTGG No data
1121501184_1121501191 10 Left 1121501184 14:94439645-94439667 CCAGTGACCACTGGGGGGATTTT No data
Right 1121501191 14:94439678-94439700 GGTACGGAACTCTGCTCTGTGGG No data
1121501184_1121501188 -6 Left 1121501184 14:94439645-94439667 CCAGTGACCACTGGGGGGATTTT No data
Right 1121501188 14:94439662-94439684 GATTTTGGCATTACCTGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121501184 Original CRISPR AAAATCCCCCCAGTGGTCAC TGG (reversed) Intergenic