ID: 1121501186

View in Genome Browser
Species Human (GRCh38)
Location 14:94439652-94439674
Sequence TAATGCCAAAATCCCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121501186_1121501192 6 Left 1121501186 14:94439652-94439674 CCACTGGGGGGATTTTGGCATTA No data
Right 1121501192 14:94439681-94439703 ACGGAACTCTGCTCTGTGGGAGG No data
1121501186_1121501191 3 Left 1121501186 14:94439652-94439674 CCACTGGGGGGATTTTGGCATTA No data
Right 1121501191 14:94439678-94439700 GGTACGGAACTCTGCTCTGTGGG No data
1121501186_1121501190 2 Left 1121501186 14:94439652-94439674 CCACTGGGGGGATTTTGGCATTA No data
Right 1121501190 14:94439677-94439699 TGGTACGGAACTCTGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121501186 Original CRISPR TAATGCCAAAATCCCCCCAG TGG (reversed) Intergenic