ID: 1121501188

View in Genome Browser
Species Human (GRCh38)
Location 14:94439662-94439684
Sequence GATTTTGGCATTACCTGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121501184_1121501188 -6 Left 1121501184 14:94439645-94439667 CCAGTGACCACTGGGGGGATTTT No data
Right 1121501188 14:94439662-94439684 GATTTTGGCATTACCTGGTACGG No data
1121501177_1121501188 27 Left 1121501177 14:94439612-94439634 CCTTCATGGTTTCGCTGGGAGGT No data
Right 1121501188 14:94439662-94439684 GATTTTGGCATTACCTGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121501188 Original CRISPR GATTTTGGCATTACCTGGTA CGG Intergenic