ID: 1121501192

View in Genome Browser
Species Human (GRCh38)
Location 14:94439681-94439703
Sequence ACGGAACTCTGCTCTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121501184_1121501192 13 Left 1121501184 14:94439645-94439667 CCAGTGACCACTGGGGGGATTTT No data
Right 1121501192 14:94439681-94439703 ACGGAACTCTGCTCTGTGGGAGG No data
1121501186_1121501192 6 Left 1121501186 14:94439652-94439674 CCACTGGGGGGATTTTGGCATTA No data
Right 1121501192 14:94439681-94439703 ACGGAACTCTGCTCTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121501192 Original CRISPR ACGGAACTCTGCTCTGTGGG AGG Intergenic