ID: 1121501476

View in Genome Browser
Species Human (GRCh38)
Location 14:94441783-94441805
Sequence AGTGGTACACACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121501470_1121501476 30 Left 1121501470 14:94441730-94441752 CCTGCTGCGTGTCTGGGCACGGA No data
Right 1121501476 14:94441783-94441805 AGTGGTACACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121501476 Original CRISPR AGTGGTACACACATGCAGCT GGG Intergenic
No off target data available for this crispr