ID: 1121502089

View in Genome Browser
Species Human (GRCh38)
Location 14:94446120-94446142
Sequence ACTGAGCAACCCAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121502084_1121502089 30 Left 1121502084 14:94446067-94446089 CCACGTACCAGTCTAAGTTCTAC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1121502089 14:94446120-94446142 ACTGAGCAACCCAATGAGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 176
1121502085_1121502089 23 Left 1121502085 14:94446074-94446096 CCAGTCTAAGTTCTACATTCTCT 0: 1
1: 0
2: 0
3: 10
4: 250
Right 1121502089 14:94446120-94446142 ACTGAGCAACCCAATGAGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121502089 Original CRISPR ACTGAGCAACCCAATGAGGC AGG Intronic
900329393 1:2126517-2126539 ACTGAGACACGCAATCAGGCTGG - Intronic
901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG + Intergenic
903459673 1:23511858-23511880 TCTGAGCAACCCTTTGAGGTAGG - Intronic
903851540 1:26309678-26309700 ACTTAACAACTCTATGAGGCTGG + Intronic
904011059 1:27390963-27390985 ACTCAACAACCCCATGAGGCCGG + Intergenic
904059669 1:27698725-27698747 ACTGAGCTACTCAAAGATGCTGG + Intergenic
904120770 1:28196293-28196315 CCTGAGCAACATAGTGAGGCAGG + Intergenic
906196418 1:43933294-43933316 GCTAAGCAACCCAACAAGGCAGG + Intergenic
906259389 1:44375224-44375246 ACCCAGCAGACCAATGAGGCTGG + Intergenic
906790686 1:48656463-48656485 ACTGTGCACCCCTCTGAGGCAGG - Intronic
910452650 1:87362738-87362760 CCATAACAACCCAATGAGGCAGG - Intergenic
910750727 1:90627398-90627420 ACTGAGCTTCTCAATGATGCAGG - Intergenic
916263275 1:162863722-162863744 TCTAAGAAACTCAATGAGGCCGG + Intronic
916398780 1:164422626-164422648 ACAGACCAACCCAGTGAGGAAGG + Intergenic
917629056 1:176875260-176875282 ACTGAGGAAGGCAGTGAGGCTGG + Intronic
920329321 1:205194044-205194066 ACTGAGAAACCCAGCAAGGCTGG - Intronic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
922210629 1:223483808-223483830 GCTGAGAAACCCACTGAGGGAGG + Intergenic
922908019 1:229190690-229190712 TCTTAGCAACCCCATGAGGTGGG + Intergenic
923671388 1:236044094-236044116 ACTGAGCAAAACAATGGGGTGGG + Intronic
924737880 1:246775338-246775360 TCACAGCAACCCTATGAGGCAGG - Intergenic
1064218460 10:13419644-13419666 ACAGAATAACCCTATGAGGCAGG + Intergenic
1066182510 10:32976990-32977012 ACTGAGCTTCCCAATGGGGTGGG + Intronic
1066315282 10:34240017-34240039 ACTGAGCAATCCTATGTGACAGG + Intronic
1068753218 10:60620414-60620436 ACCTAACAACCCTATGAGGCAGG + Intronic
1070148846 10:73793154-73793176 ACAGAGCAGCCAAGTGAGGCTGG - Intronic
1070513228 10:77179801-77179823 TCAGAGCAAACCTATGAGGCAGG - Intronic
1070546906 10:77459563-77459585 ACTGAGCGTCCCCATTAGGCAGG + Intronic
1074532707 10:114307859-114307881 ACTGAGCAACCTAATGAATCTGG - Exonic
1074744649 10:116519970-116519992 AAAAAACAACCCAATGAGGCAGG - Intergenic
1074768766 10:116719745-116719767 ATTAAACAACCCAATGAGGTGGG + Intronic
1075447839 10:122526183-122526205 AATAAGCAAGGCAATGAGGCTGG - Intergenic
1076757861 10:132583401-132583423 CCTGACCAGCCCAACGAGGCAGG - Intronic
1078358329 11:10649172-10649194 CCTGAGAAACCCAATGTGGGTGG + Intronic
1078694980 11:13622132-13622154 TCTCAGCAACCCAGTGAGGTAGG + Intergenic
1078949108 11:16108742-16108764 CCTCAGCAACCCACTGAGGTGGG + Intronic
1081585478 11:44381074-44381096 TCTGAGCAACCCCGTGAGGCAGG - Intergenic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1085693787 11:78687049-78687071 ACTGAGCAGCCCTGTGGGGCAGG + Intronic
1089360669 11:117884239-117884261 TCTGAGCAACAGAAAGAGGCAGG + Intergenic
1090712808 11:129403158-129403180 ACTGGGGAACCCAAAGGGGCTGG - Intronic
1090837505 11:130464010-130464032 ACAGAGCAAGGCAAGGAGGCGGG + Intronic
1092034433 12:5319384-5319406 AGTCAACAACCTAATGAGGCTGG + Intergenic
1092303260 12:7273088-7273110 ACTGAGCCACCTCATGAGGATGG - Intergenic
1093401646 12:18753638-18753660 AGTGAGCAAGCCAACAAGGCGGG + Intergenic
1095532069 12:43200249-43200271 ACTCAGCAACCCTATGAGGAAGG - Intergenic
1098115292 12:67169547-67169569 ACTGAGCAACGAAATCAGACAGG - Intergenic
1098159423 12:67634959-67634981 TCACTGCAACCCAATGAGGCAGG - Intergenic
1099490793 12:83285576-83285598 ACAGAGCAAGCCCATGTGGCAGG + Intergenic
1103232991 12:119347802-119347824 TCTCAACAACCCGATGAGGCAGG - Intronic
1105418887 13:20235583-20235605 CCTGAGCAACACAGTGAGACCGG + Intergenic
1106641611 13:31589660-31589682 ACTGAGCAACCAACTGAAGCAGG - Intergenic
1107989852 13:45810169-45810191 ACTGAGCATCCTCAGGAGGCTGG - Intronic
1111215551 13:85135642-85135664 ACTCAGCAACTCAATGAGGAAGG + Intergenic
1112717085 13:102199434-102199456 TCAGAACAACCCAATGAGCCAGG + Intronic
1113126545 13:106985358-106985380 ACTGTGCAAAGCAATAAGGCAGG - Intergenic
1117804969 14:59482139-59482161 ACTCAGCAACCCTCTGAGGTGGG + Intronic
1118067399 14:62206935-62206957 ACTCAGCAAAGCCATGAGGCAGG - Intergenic
1118859339 14:69650332-69650354 GCACAGCAACCCAATGAGGTGGG + Intronic
1119848406 14:77847698-77847720 ACTGTGCAGCCCAACAAGGCAGG - Intronic
1119884028 14:78125154-78125176 TCAGAGCAACCCCATGAGGTAGG - Intergenic
1121502089 14:94446120-94446142 ACTGAGCAACCCAATGAGGCAGG + Intronic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1124111877 15:26797953-26797975 CCTGAGCAACACAGTGAGACAGG + Intronic
1126019731 15:44388556-44388578 ACTCAGCCACCCAAGGAGGTGGG - Intronic
1126958584 15:53963488-53963510 TCTCAACAACACAATGAGGCAGG - Intergenic
1127318291 15:57817863-57817885 AGTTAGCCAACCAATGAGGCAGG - Intergenic
1127806342 15:62524419-62524441 TCTCAGCACCCCGATGAGGCAGG - Intronic
1128223588 15:65985743-65985765 ACTGTGCACCCCAATAGGGCAGG - Intronic
1128667662 15:69550375-69550397 AATCAGCAACCCAAAGAGGTGGG - Intergenic
1128748985 15:70135027-70135049 ACTGAGCAGTTCAGTGAGGCTGG - Intergenic
1129794961 15:78369147-78369169 CCTCAACAACCCCATGAGGCTGG - Intergenic
1129826379 15:78637633-78637655 ACAGACCAACCCAATTAGGCAGG + Intronic
1133413407 16:5587150-5587172 AGTGAGCAACCCATTGAGTTGGG + Intergenic
1133950744 16:10390197-10390219 ATGGAGAAACCCAATGAAGCAGG + Intronic
1134627522 16:15733079-15733101 TCAGAGCAACCCAAAGAGGCAGG + Intronic
1134814000 16:17191016-17191038 ACAGAACAACCAAATAAGGCAGG - Intronic
1134862448 16:17572628-17572650 TCTGACCAAACCAAAGAGGCAGG + Intergenic
1135882358 16:26270394-26270416 CTTGACAAACCCAATGAGGCAGG + Intergenic
1139941618 16:70609775-70609797 TTTCAGCAACCCCATGAGGCTGG + Intronic
1142571200 17:875787-875809 CCTGAGCAACAAAATGAGACCGG - Intronic
1145250137 17:21292974-21292996 TCTCAGCAACCCCTTGAGGCAGG - Intronic
1145844267 17:28024151-28024173 TCTTAGCAACCCTATGAGGATGG - Intergenic
1146579479 17:34024173-34024195 GCTGAGCAGCCCAATCTGGCTGG - Intronic
1148697022 17:49566868-49566890 GTTGCGCAACCCAATGAGGTAGG - Intergenic
1148979503 17:51560158-51560180 TCTGGGGAACCCAATGAGGGAGG - Intergenic
1150203577 17:63382206-63382228 ACTGAGAACCGCACTGAGGCTGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153534102 18:6082142-6082164 TCTGAACAACCCAGTGAGGCAGG - Intronic
1153610021 18:6874855-6874877 ACAGAGCAGCCCAAAGAGGCTGG + Intronic
1155867962 18:30990178-30990200 ATTCAACAACCCCATGAGGCTGG + Exonic
1157271297 18:46278304-46278326 ACTGTCCAACTCAAAGAGGCTGG - Intergenic
1158540220 18:58346922-58346944 ACCGAGCCACTCAAGGAGGCAGG - Intronic
1160401126 18:78612200-78612222 ACTGCCGAACCCAATCAGGCCGG - Intergenic
1162606199 19:11709963-11709985 AGTCAGCAACACACTGAGGCTGG + Intergenic
1163275612 19:16282415-16282437 ACAGAGCAACCCAAACAGGTTGG + Intergenic
1164520389 19:28974614-28974636 ACACAGCAACCTAAGGAGGCAGG - Intergenic
1165733967 19:38164247-38164269 TCTGAGCAGCCCCATGAGGCAGG + Intronic
925355196 2:3236131-3236153 ACTGAACAACCCTGTGAGGCAGG + Intronic
925366063 2:3313081-3313103 ACCCAGTGACCCAATGAGGCTGG + Intronic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927377920 2:22440079-22440101 AAGCAACAACCCAATGAGGCAGG + Intergenic
928670088 2:33594108-33594130 TCAGGGCAACCCTATGAGGCAGG - Intronic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
935178265 2:100668361-100668383 CCTGAGCAAACCCTTGAGGCAGG + Intergenic
935425485 2:102914323-102914345 ACTGAGGAACATAATGAAGCTGG - Intergenic
936141914 2:109948048-109948070 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936178602 2:110245996-110246018 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936202776 2:110423436-110423458 GCTGAGCAGCCCAATGAGCAGGG + Intronic
942591850 2:177554755-177554777 ACTGGCCAACCCAAGGTGGCTGG - Intergenic
943755250 2:191550510-191550532 TCTCAGCAACCCTCTGAGGCAGG - Intergenic
947534330 2:230931504-230931526 CCTCACCAACCCCATGAGGCAGG + Intronic
1169842410 20:9954632-9954654 AGGGAGGAAACCAATGAGGCTGG - Intergenic
1170709645 20:18778789-18778811 TCACAGCAACCCAATGAGGGAGG - Intergenic
1172134192 20:32676055-32676077 CCTGTCCAACCCACTGAGGCAGG + Intergenic
1172603284 20:36198024-36198046 CCTGAGAAAGCCAATGAGGTAGG + Exonic
1173212409 20:41045533-41045555 TCTCAGCAACCCTATGAGGTAGG + Intronic
1175170879 20:57080653-57080675 ACTGAGCTTCCCATTGAAGCTGG + Intergenic
1176046366 20:63094857-63094879 ACTGGGCATCCCAAGGAAGCTGG + Intergenic
1180011077 21:45051871-45051893 CCTCAGCAACCCCAGGAGGCTGG - Intergenic
1180024565 21:45152556-45152578 ACTGAGGGACAGAATGAGGCTGG + Intronic
1180886064 22:19244761-19244783 ACTCAGCAGCCCCATGAGGTGGG - Intronic
1181592730 22:23895001-23895023 ACTGAGCCACCCGCTGAGTCCGG + Exonic
1182451068 22:30422171-30422193 ACTGAGCAAGGCAGTGTGGCAGG - Intronic
1183067457 22:35372817-35372839 GCTGAGGAACCCAAAGAGGCAGG + Intergenic
1183827285 22:40398338-40398360 ACTGAGCACCCCTAAGAGCCAGG - Intronic
949418049 3:3834194-3834216 ACCGAGGAACACAATGAAGCTGG - Intronic
949476611 3:4452702-4452724 TCACAGCAACCCCATGAGGCAGG - Intronic
954705775 3:52479841-52479863 ACTGAGCAACCCAGAGAAGAAGG + Exonic
955149281 3:56350901-56350923 TCTCAGCAACCCTATGAAGCAGG + Intronic
955382715 3:58452966-58452988 ATTAAGAAACCCACTGAGGCTGG - Intergenic
955737787 3:62058132-62058154 ACAGAGAAACGCAATAAGGCTGG - Intronic
956457013 3:69431601-69431623 ACTGAGCAACTCTATAAGGTAGG + Intronic
960272925 3:115693986-115694008 GTTGAGCATCCCAGTGAGGCAGG + Intronic
962930968 3:140035610-140035632 ACAAAACAACCCTATGAGGCAGG - Intronic
964541079 3:157780741-157780763 TCAGAACAACCCAATGAGGCAGG + Intergenic
968459706 4:718383-718405 ACTGAGCTACACTCTGAGGCTGG + Intronic
973755094 4:54066248-54066270 GCTGAGCATCCCAATGGGGCAGG - Intronic
980084241 4:128375131-128375153 GCTGAGTAACTCAAGGAGGCTGG + Intergenic
981585961 4:146302667-146302689 ACTGAGAAAACCAGAGAGGCTGG + Intronic
981821836 4:148896328-148896350 TCTCAACAACCCTATGAGGCAGG + Intergenic
985023984 4:185720990-185721012 TCTGAGCAATCCCATGAGGCAGG - Intronic
985654649 5:1123575-1123597 GCTCAGCAAGGCAATGAGGCCGG + Intergenic
988793642 5:34632346-34632368 ACTGAGGAACCCAAGGTGGATGG + Intergenic
989952932 5:50322392-50322414 AATGATTAAGCCAATGAGGCAGG + Intergenic
992093959 5:73343099-73343121 ACTCAGCAACTCCATGATGCTGG - Intergenic
994748233 5:103706015-103706037 ACTCAGCAACCCAATAAAGTAGG + Intergenic
997009355 5:129858577-129858599 ACTGAGCTTCCCACTGATGCTGG - Intergenic
997602228 5:135148519-135148541 CCTCAGCAACCCTATGATGCAGG - Intronic
997976861 5:138445981-138446003 ACTGAGCCACCCAAGGAGGTGGG + Exonic
998052967 5:139051690-139051712 ACAGAGCAAGCCAAGGAGGCAGG + Intronic
999202839 5:149828469-149828491 ACTGAGCAACTCTATGTGCCAGG - Intronic
999887383 5:155937819-155937841 CCTGAACACCCCAATGAGGCAGG - Intronic
1000332182 5:160214562-160214584 TCTCAGCCACCCAATGTGGCTGG + Intronic
1000380184 5:160622026-160622048 ACCCAGCAACTCTATGAGGCAGG - Intronic
1003521728 6:6863736-6863758 ACTGAGCTTCCCAATGACTCTGG + Intergenic
1005283359 6:24298588-24298610 ACTGAGCGACCCTATGAGGTAGG - Intronic
1005339817 6:24832935-24832957 TCAAAACAACCCAATGAGGCGGG + Intronic
1006220753 6:32488520-32488542 AGAGACCAACCCAATGAGCCTGG - Intergenic
1006750928 6:36376466-36376488 ACTGAACAACCCAATGAAAGGGG + Intronic
1007662840 6:43496966-43496988 ACTGAGCTATCCAGTGAGGAAGG + Intronic
1008106564 6:47445434-47445456 ACTGAACAACCCTAGGAAGCAGG + Intergenic
1008449369 6:51632265-51632287 ACACAACAACCCAATGAGGTGGG - Intronic
1010535938 6:77030464-77030486 ATTGAGCAAAGCATTGAGGCAGG + Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1013959335 6:115880258-115880280 TCACAGCAACCCAATGAGGTAGG + Intergenic
1016779411 6:147941703-147941725 ACAGAGCAACTCAATGAGAATGG + Intergenic
1016977729 6:149825539-149825561 TCTCAGCAACCCTATGAGGCAGG + Intronic
1020853851 7:13391995-13392017 ACTGTGGTACTCAATGAGGCAGG + Intergenic
1022334127 7:29406618-29406640 ACTGATCAAAACAATGACGCTGG - Intronic
1023967871 7:44972532-44972554 TCTGAGCTACCCACTGAGGTGGG - Intronic
1027405845 7:77859764-77859786 CCTGAGCAACACAGTGAGACAGG - Intronic
1030463360 7:109868671-109868693 ACTGATCTTCCTAATGAGGCAGG - Intergenic
1031436041 7:121733105-121733127 CCTGATCAACACAAGGAGGCAGG - Intergenic
1040292679 8:46133422-46133444 ACTCAGGGACCCATTGAGGCAGG - Intergenic
1042182369 8:66103999-66104021 ACACAGCAACCCTATGAGGTAGG + Intergenic
1043441168 8:80278299-80278321 CCTGAGCAACCCTGTGAGGCAGG - Intergenic
1045492190 8:102678585-102678607 ACTGAACAAACCAGTGAGCCAGG - Intergenic
1047188434 8:122656511-122656533 ACTGAACATCCCAGTGATGCTGG - Intergenic
1048140787 8:131792181-131792203 TCAAAGCAACCCAATGAGGTGGG + Intergenic
1049122611 8:140752882-140752904 CATGAGCAAGCCAGTGAGGCTGG + Intronic
1050574035 9:6974016-6974038 ATTGAAAAACCCAAAGAGGCTGG + Intronic
1051013974 9:12452722-12452744 ACTGTGCAATCCAATGAGATAGG - Intergenic
1051326403 9:15975547-15975569 ACTGGGCAACACAGTGAGGGTGG - Intronic
1052200738 9:25776437-25776459 ACAGAGCAGACCAATAAGGCAGG + Intergenic
1053278773 9:36802960-36802982 AATGAGGAACCCAGTGAGACTGG + Intergenic
1058045027 9:100349221-100349243 CCTGAGCAACTCAAAGAGGATGG - Exonic
1060138238 9:121178831-121178853 AATGAGCAACCTCAAGAGGCAGG + Exonic
1060916784 9:127396840-127396862 ACTGAGCTGGCCAATGAGGTTGG - Intergenic
1061130988 9:128707597-128707619 ACACAGCAACCCTATGAGGTAGG - Intronic
1061920631 9:133780457-133780479 ACTGGGCAAGGGAATGAGGCGGG + Intronic
1186171897 X:6885618-6885640 ACTGTGCAAACCAATGAGTAAGG - Intergenic
1188474384 X:30574521-30574543 ACTAAGACACCCAAAGAGGCTGG + Intronic
1193405724 X:81098845-81098867 ATATAGCAACCCCATGAGGCAGG - Intergenic
1194235559 X:91379516-91379538 CCTGAGGAGCCCAAGGAGGCTGG - Intergenic
1196289108 X:113917533-113917555 ACTTTGAAACTCAATGAGGCTGG - Intergenic
1196943715 X:120803288-120803310 ACTGAGCAACCCAAGCATGGAGG - Intergenic
1197887036 X:131229273-131229295 ACACAACAACCCAATGAGGTAGG - Intergenic
1201326254 Y:12762401-12762423 ACAGAGCACCCTAGTGAGGCTGG - Intronic