ID: 1121502382

View in Genome Browser
Species Human (GRCh38)
Location 14:94448504-94448526
Sequence CCTGGCCCTGCTCTCTCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 414}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121502382_1121502392 18 Left 1121502382 14:94448504-94448526 CCCCAAGAGAGAGCAGGGCCAGG 0: 1
1: 0
2: 3
3: 40
4: 414
Right 1121502392 14:94448545-94448567 GGCGAGAAGAAGATGTTTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 134
1121502382_1121502391 17 Left 1121502382 14:94448504-94448526 CCCCAAGAGAGAGCAGGGCCAGG 0: 1
1: 0
2: 3
3: 40
4: 414
Right 1121502391 14:94448544-94448566 TGGCGAGAAGAAGATGTTTCCGG 0: 1
1: 0
2: 2
3: 13
4: 138
1121502382_1121502390 -3 Left 1121502382 14:94448504-94448526 CCCCAAGAGAGAGCAGGGCCAGG 0: 1
1: 0
2: 3
3: 40
4: 414
Right 1121502390 14:94448524-94448546 AGGGTGGTGGAGATGCTCACTGG 0: 1
1: 0
2: 0
3: 24
4: 267
1121502382_1121502393 19 Left 1121502382 14:94448504-94448526 CCCCAAGAGAGAGCAGGGCCAGG 0: 1
1: 0
2: 3
3: 40
4: 414
Right 1121502393 14:94448546-94448568 GCGAGAAGAAGATGTTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1121502382_1121502394 20 Left 1121502382 14:94448504-94448526 CCCCAAGAGAGAGCAGGGCCAGG 0: 1
1: 0
2: 3
3: 40
4: 414
Right 1121502394 14:94448547-94448569 CGAGAAGAAGATGTTTCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121502382 Original CRISPR CCTGGCCCTGCTCTCTCTTG GGG (reversed) Exonic
900272794 1:1801453-1801475 TCTGCCCTTGCTCACTCTTGTGG - Intronic
900368931 1:2322934-2322956 CCTGGGCCAGCTCTCACTTAGGG + Intronic
900405427 1:2490867-2490889 CCTGGCCCTGCCATCTCCTGAGG + Intronic
900829561 1:4956197-4956219 TTTGGCCCTGCTCTCCCTTAAGG - Intergenic
901204064 1:7483904-7483926 CCTGGGCCTGTTCCCTCCTGGGG + Intronic
901416536 1:9120459-9120481 CCCAGCCCTGCTCTGTCCTGAGG - Intronic
901862139 1:12081219-12081241 CCAGGCCCTGCTCACTCTGCTGG - Intronic
902631355 1:17706440-17706462 CCTGACCCTGCTCTCCCATGGGG + Intergenic
902717611 1:18283306-18283328 GCAGTCCCTGCTCTCCCTTGTGG - Intronic
902728022 1:18350226-18350248 CCTGGCCCATCTGGCTCTTGAGG - Intronic
903754359 1:25650531-25650553 CCTGGACCTGCTCTCTCTGCGGG - Intronic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
904663345 1:32101484-32101506 CCTGGCACTGCTCTGTTTGGAGG + Intronic
905205401 1:36340412-36340434 CCTGGCCCTGCTCCCCAGTGGGG - Exonic
905213946 1:36393652-36393674 CCTGGCCCTGCTTTCTTCTCGGG + Exonic
905290983 1:36921820-36921842 CCTGGCCCTGCTTTGTCCTGAGG + Intronic
905294306 1:36944547-36944569 TCTGGCTCTGGCCTCTCTTGTGG - Intronic
906155937 1:43613907-43613929 CCTGGCCCAGCACCTTCTTGGGG + Intronic
907307606 1:53522002-53522024 CCTGGCCCTGCTGTCTTAGGAGG - Intronic
907726747 1:57027236-57027258 CCTGGGGCTCCTTTCTCTTGTGG - Intronic
908116906 1:60949632-60949654 CATGGCCCAGCTCTCCCATGCGG + Intronic
908184728 1:61641866-61641888 CCTGGGCCTGCTCTCTGCGGCGG - Intergenic
908252896 1:62279104-62279126 ACTTGCCCTCCTCTCCCTTGTGG - Intronic
912960106 1:114188559-114188581 CCTGCCCCTGCTGTGTCTGGAGG - Intergenic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
915119169 1:153617765-153617787 CCCGCCCCTGCTCCCTCTGGTGG + Intergenic
915617551 1:157051092-157051114 TTTGGCCCTCATCTCTCTTGAGG + Intergenic
915706579 1:157849516-157849538 CCTGCCCCTGCTCCTTCTTTAGG + Intronic
915971238 1:160356700-160356722 CCTGGCACTGCTCTCGGGTGAGG - Exonic
916497101 1:165356133-165356155 CCTGGCGCTGCGCTCTGTTGGGG + Intronic
916626192 1:166557937-166557959 CCTTGCCCTGCTTTGTCTAGTGG - Intergenic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
917240480 1:172942796-172942818 CCTCTCTCTGCTCTCTCTTGAGG - Intergenic
919756142 1:201067286-201067308 CCTGGCCCTACTGTCTCCTGTGG + Intronic
920107232 1:203562611-203562633 CCTTGCACTACTCTCTCCTGTGG - Intergenic
920174153 1:204089715-204089737 GCTGCCCCTGCCCTCTCTTCCGG - Intronic
920414971 1:205793116-205793138 CCTGGCCATGCTCTTTATTTGGG - Intronic
921650721 1:217674740-217674762 CCTTGCCCTGCTCTGGCCTGTGG + Intronic
921776093 1:219101920-219101942 CCTGGCAAAGCTCTCTCGTGGGG + Intergenic
922155946 1:223039661-223039683 CCTGGCCCAGCTGTCTCTGTGGG - Intergenic
922701821 1:227765763-227765785 CCTGGAGCTGCTCCCTCTTTAGG + Intronic
923092460 1:230750791-230750813 CCTTGCCCTGGGCTCCCTTGAGG - Intronic
1062798110 10:359245-359267 GGTGGCCCTGCTCTCCCTGGGGG - Intronic
1064366656 10:14714520-14714542 CCTGGGCCTGCTGTCTACTGAGG - Intronic
1067539342 10:47140399-47140421 TCTGGCCCTGCTCTCCCCAGTGG - Intergenic
1067687394 10:48475251-48475273 TCTGGCTCTCCTCCCTCTTGGGG + Intronic
1069817916 10:71210273-71210295 CCGGGCCCTGCTCTCCCTCCAGG - Intergenic
1071561598 10:86650177-86650199 CCCTGCTCTGCTCTCTGTTGCGG + Intergenic
1072211477 10:93250419-93250441 CCTGCCCCTCCTCCCTCATGGGG - Intergenic
1072709400 10:97706233-97706255 CCTGGCCCCACTCACTCTTGGGG + Intergenic
1072715035 10:97745472-97745494 CCTGGCCCTGTTCTTTCTGCTGG + Intronic
1072806926 10:98429694-98429716 CCTGTCCCTGCTCTCCCAGGAGG + Intronic
1073530052 10:104222526-104222548 CCAGACACTGCTCTCTCATGAGG - Intronic
1074771516 10:116737932-116737954 GCTGGCCCCGCTCACTCCTGGGG + Intronic
1075111933 10:119595266-119595288 CTTGGCTCTGCTCTCTGATGGGG - Intronic
1075592766 10:123704314-123704336 CTGGGCTCTGCTTTCTCTTGTGG + Intergenic
1075765247 10:124887785-124887807 CCTGGCCTTACTCTTTCTTAAGG + Intergenic
1076445466 10:130510965-130510987 CCTGGCCCAGCACTCACATGAGG - Intergenic
1076569078 10:131420486-131420508 CCCAGCGCTGCTCTCTCTGGGGG + Intergenic
1076654517 10:132014730-132014752 TCTCGCCCTGCTCTGTCTAGTGG - Intergenic
1076655966 10:132023586-132023608 CCTGGCCCTGCTGCCCCTTCTGG - Intergenic
1077046777 11:550206-550228 CCTGGCCATGCTCACCCTGGAGG + Exonic
1077181278 11:1218325-1218347 CCTGACCCTGCCCTCACTTCTGG + Intergenic
1077911203 11:6572281-6572303 CCTTGCCCCGCTCTCTACTGTGG + Intronic
1078668739 11:13346706-13346728 CCATGCCCTGCTTTCTCTGGCGG + Intronic
1080472380 11:32558894-32558916 CCGGGCTGTGCTCTCTCTGGGGG + Intergenic
1081907790 11:46680337-46680359 CCTGCCCCTTCTCTGTCTTGGGG + Intronic
1083303053 11:61748740-61748762 CCTGGCCCTGCTCCCACTCAAGG + Intergenic
1083459797 11:62803462-62803484 CCAGCCCCTCCTCTCTCTGGAGG + Exonic
1083997613 11:66279851-66279873 CCTGGCTCTGCTCTCTCTCTGGG + Intronic
1084313686 11:68331500-68331522 CCTGGCCCATCTCCCTGTTGAGG + Intronic
1084327846 11:68412003-68412025 GCTGGCCCTGGTATCTCTGGGGG - Intronic
1084555495 11:69873527-69873549 CCTGGAGCTGCTGTCTATTGTGG - Intergenic
1085034365 11:73291293-73291315 CCTTGCCCTGCCCTGCCTTGGGG + Intronic
1085529137 11:77181385-77181407 CCTGGCCCAGCTGGCTCGTGAGG + Exonic
1086398182 11:86438590-86438612 CCTGGACCTGGTTTTTCTTGGGG + Intergenic
1089355932 11:117853786-117853808 CCTGGCCCAGTTATCTCATGGGG + Intronic
1089497181 11:118913735-118913757 CCTGGCCCTTGCCTCTGTTGGGG - Intronic
1090428878 11:126629506-126629528 CTTTGCACTGCTCTCTCTAGGGG + Intronic
1091237981 11:134034336-134034358 CCAGGCCCTGCTCTCTGCAGAGG - Intergenic
1091284004 11:134397922-134397944 CCTTGCCCAGCACTCTCTTGAGG + Intronic
1091401301 12:182300-182322 CCTGGGCTTGGTCTATCTTGGGG - Intergenic
1092402182 12:8186088-8186110 CCTGGACCAGCTATTTCTTGGGG - Intronic
1092615482 12:10212532-10212554 CCTGGCCCTCTTTTCTCCTGAGG + Intronic
1094188904 12:27676787-27676809 TCTCACCCTGCTCTCTCCTGTGG + Intronic
1095797998 12:46241534-46241556 CCTGGCTCTCCTCCTTCTTGAGG - Intronic
1097864049 12:64544123-64544145 CCTGGTACTGCTCACTCTTTGGG + Intergenic
1097903714 12:64899025-64899047 CCAGGCACTACTTTCTCTTGAGG - Intergenic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1103924143 12:124414447-124414469 CCTGGCCCTGCTGTGTGATGGGG - Intronic
1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG + Intergenic
1104984460 12:132588747-132588769 GCTTCCCCTGCTCTCTCGTGAGG + Intergenic
1106015402 13:25864312-25864334 CCTGGCACAGCTCTCTGTTTAGG - Intronic
1106188076 13:27426010-27426032 CCCCGCCCAGCTCCCTCTTGCGG + Intronic
1106887615 13:34206844-34206866 CAGGGCCCTGCTCCCTCTGGAGG + Intergenic
1107931601 13:45311863-45311885 CCTGGCCTTTGTCTCTCTGGCGG - Intergenic
1108218954 13:48213728-48213750 CCTGGCCATGTTCTCTTTTATGG + Intergenic
1108728030 13:53202176-53202198 CGTGGCTCTCCTCTCTCGTGCGG - Intergenic
1108805639 13:54152368-54152390 TCTGAACCTTCTCTCTCTTGGGG + Intergenic
1109082718 13:57926598-57926620 TCTGGACCTGCTCTCTCCTCAGG + Intergenic
1110395547 13:75026193-75026215 CCTGGCCCTTCTCCTTCTGGTGG - Intergenic
1110770327 13:79335849-79335871 TCTGGCTCTCCTTTCTCTTGTGG + Intronic
1113629663 13:111873715-111873737 CCAGGCCCAGCTGTCTCTAGTGG + Intergenic
1113765333 13:112877538-112877560 GCTGCACCTGCTCTCTCTCGGGG - Intronic
1113909355 13:113834859-113834881 CCTGCCCGGGCTCTTTCTTGAGG + Intronic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1114919819 14:27312440-27312462 TCTCGCCCTGCTCTGTCTAGTGG - Intergenic
1115399015 14:32938305-32938327 CCTGCCCCAGCTCGCTCCTGTGG + Intronic
1116516046 14:45807137-45807159 TCAGGCCCAGCTCTCTCTTTTGG - Intergenic
1117815456 14:59593141-59593163 CAGGGCCCTGCTCTCTTTTTCGG - Intergenic
1118001247 14:61525902-61525924 CCCGGCCGTGCTCTCTCCTGGGG + Intronic
1118921001 14:70149891-70149913 CCTGGGGCTGCTCTGTCTTTGGG + Intronic
1119041973 14:71282577-71282599 TCTGGCCTTGCTCTCTCCTGGGG - Intergenic
1119516944 14:75255736-75255758 CTTTGCCATTCTCTCTCTTGAGG - Intronic
1119850385 14:77862425-77862447 CCTGGCCCTTCTCTTTGTGGGGG + Intronic
1121439567 14:93940179-93940201 CCAGACCCTGCTCTCTCTGGGGG + Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1121521263 14:94587587-94587609 CCTGGCCATGCTCTCCCTGGGGG + Exonic
1122059939 14:99130258-99130280 CTGGGCACTGCTCTTTCTTGGGG - Intergenic
1122204832 14:100143197-100143219 CCTGGCTCTGCTCACTCCTCAGG - Intronic
1122295699 14:100704596-100704618 CCTGTCCCTTCTCTCTGGTGAGG - Intergenic
1122401461 14:101469829-101469851 CCTGGCCTTGCTCTTGCTTCAGG - Intergenic
1122599176 14:102912749-102912771 CCCGGCCCAGCTCACACTTGCGG - Intergenic
1202930291 14_KI270725v1_random:28795-28817 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1202943357 14_KI270726v1_random:4666-4688 CTTGGCCCTGCCCTCTCCTCAGG + Intergenic
1123536217 15:21187194-21187216 CCTAGCCCTGCTCTCTGTGCTGG - Intergenic
1124883058 15:33659929-33659951 CCAGGCCCTGCCCTTTCCTGTGG + Intronic
1125417178 15:39466151-39466173 CCTCGCCTTGCTCTTTCCTGTGG + Intergenic
1126311325 15:47320034-47320056 CTGTGCCCTCCTCTCTCTTGAGG + Intronic
1126818910 15:52482083-52482105 TCTAGCTCTTCTCTCTCTTGTGG - Intronic
1127092601 15:55481582-55481604 TCTTGCCCTGCTCTGTCTAGTGG - Intronic
1127285542 15:57529966-57529988 CCTGGCTCTGATCTCTTTAGGGG + Intronic
1127770763 15:62228708-62228730 CCCTGCCCTGGTCTCTCTTCTGG - Intergenic
1128311031 15:66631925-66631947 TCTGGCCCTGCTCCCTGTTCGGG + Intronic
1128341703 15:66826849-66826871 CCTGGCTCTGCCCTCTCCTCTGG - Intergenic
1128865308 15:71110660-71110682 CCTGTATCTGCTCTCTTTTGTGG + Exonic
1129686341 15:77688179-77688201 CCTGGCCCTGCTGTCTTCAGAGG - Intronic
1130064352 15:80592143-80592165 CCTGGCTCTGCTCTCCTCTGTGG + Intronic
1130196711 15:81786173-81786195 GCTGGCCCTGCTCTCTTTTCTGG - Intergenic
1131091385 15:89627251-89627273 CCTGGCCCTGCCCCTTGTTGGGG + Exonic
1132196579 15:99918334-99918356 GCTGGCCTTGCCCTTTCTTGCGG - Intergenic
1132319840 15:100918109-100918131 CCTGGGCCTGCGCTCCCTCGCGG + Intergenic
1132896847 16:2233298-2233320 ACTGGCCCTGCTCTCCCTGTGGG - Intronic
1133240779 16:4413066-4413088 CCTGGCCATGCTCTTGCCTGTGG + Intronic
1133530533 16:6651259-6651281 CCTGGCCATGCTCTCCATGGAGG - Intronic
1134861973 16:17568381-17568403 CCAGGCCCTTCTCTTGCTTGGGG + Intergenic
1135875471 16:26196041-26196063 CCTGGAAATGCTGTCTCTTGAGG + Intergenic
1135959919 16:26986903-26986925 CCTGGCCTGGAGCTCTCTTGAGG - Intergenic
1135981948 16:27154691-27154713 CCTGGCCCTGCTTTCTTTCCCGG + Intergenic
1136227713 16:28870201-28870223 CCTGGCCCTGCTCTGTGTCCCGG + Intronic
1136569521 16:31088371-31088393 CCTGGCTCAGCTGTCTCATGGGG - Intronic
1136873219 16:33827022-33827044 CTGGGTCCTGCTCTCTCTTCAGG + Intergenic
1137614789 16:49839673-49839695 CCCGGCTCTGTTCTCTCTGGAGG - Intronic
1138157335 16:54718257-54718279 CCTGTCCCTGATCTATCGTGTGG - Intergenic
1139658846 16:68406391-68406413 CCTGGCCCTCCTCTTCCTTGGGG + Intronic
1140202679 16:72907003-72907025 CCTGGCCGTGCTTTCTCCCGGGG + Intronic
1140515165 16:75535942-75535964 CTTGGCCCTCCTCGCTCTTGGGG + Intronic
1140722374 16:77783849-77783871 CCTGCCGCTGCTCACTCTTTGGG - Intergenic
1141674740 16:85511820-85511842 CAGGGCCCTGCTCCCTCTGGAGG - Intergenic
1141725746 16:85787272-85787294 CAAGGCCCTGCTCACTCTCGAGG + Intronic
1141980349 16:87546442-87546464 CCAGGCCCTGCTCACTCTCAAGG + Intergenic
1203098953 16_KI270728v1_random:1289033-1289055 CTGGGTCCTGCTCTCTCTTCAGG - Intergenic
1143251785 17:5528212-5528234 CCTGGCCACGGTCTCACTTGTGG + Intronic
1144152319 17:12461471-12461493 CATGTCCCTGGTATCTCTTGTGG - Intergenic
1144295785 17:13873677-13873699 TCTGTCCCTGGTCTCTCTTCTGG - Intergenic
1144353309 17:14420233-14420255 CATGGCCCTGCAGGCTCTTGAGG - Intergenic
1144626488 17:16846755-16846777 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1144672625 17:17141535-17141557 CCTCGCCCTCCTCTCTCCGGGGG + Intronic
1144676301 17:17164369-17164391 CCCGGCCCTGCTCCCGCTTCAGG - Intronic
1144712777 17:17413224-17413246 CCAGGCAGGGCTCTCTCTTGAGG - Intergenic
1144879944 17:18425956-18425978 CCTGACCCTGAGGTCTCTTGGGG + Intergenic
1145152289 17:20518428-20518450 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1145271153 17:21405610-21405632 CCAGGCCCTGCCCTCCCCTGCGG + Intronic
1145281135 17:21467902-21467924 CCTGCCCCTGCCCCCTCTTGTGG + Intergenic
1145309357 17:21692997-21693019 CCAGGCCCTGCCCTCCCCTGCGG + Intronic
1145839448 17:27982203-27982225 CCTGCCCCAGCTATCTCTTAGGG + Intergenic
1146163639 17:30572635-30572657 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1146179108 17:30685979-30686001 CCAGGCCCTGACCTCTCTGGGGG - Intergenic
1146978041 17:37132638-37132660 AATGGCCCAGCTCTCTCTTCTGG - Intronic
1147248550 17:39138662-39138684 CCTGCCCCTCCTCTCCCCTGGGG - Intronic
1147262140 17:39214819-39214841 CCTGGCCCTTCACTCTCTGCTGG + Exonic
1147365034 17:39953558-39953580 CCAGGCCCCAGTCTCTCTTGCGG - Intergenic
1147389245 17:40099280-40099302 CCTGGCCCTGCTATCGTTCGGGG - Intronic
1147444913 17:40469168-40469190 TCTGGCCCTGTTCTCTCTCTGGG + Intergenic
1147580633 17:41625446-41625468 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1147727522 17:42575706-42575728 CCTGGCCCTTACCTCTTTTGAGG - Intronic
1148368608 17:47076034-47076056 CAGGGCCATGCTCTCTCTGGAGG - Intergenic
1148697156 17:49567547-49567569 CCAGGCCCGGCACTCTCTGGAGG - Intergenic
1149404078 17:56329189-56329211 TCTGGCCCTGCTACCTCTTCAGG + Intronic
1150967678 17:69990172-69990194 TATGGTCCTGCTCTCTCTTTTGG - Intergenic
1151328028 17:73390836-73390858 CCTGCCCCCACTCTGTCTTGGGG + Intronic
1152379399 17:79934615-79934637 GCTGGCTCTGCTCTTTCCTGGGG + Exonic
1152435214 17:80272370-80272392 CCTGGCCCTGATGTCTGGTGAGG + Intronic
1152504521 17:80739113-80739135 CCTGGCCCTGCTTGCTGTCGCGG + Intronic
1152740112 17:82015024-82015046 CCGGGCCCTGCTCTGGCTGGGGG + Intronic
1154496228 18:14963338-14963360 GCTTGCCCTGCCCTCTCTTTCGG + Intergenic
1157006567 18:43590258-43590280 CCTGGCCCAGCTCCTCCTTGGGG + Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1158776589 18:60589292-60589314 CCTGGCTCTGTTGTCTCCTGTGG - Intergenic
1159053244 18:63441256-63441278 CCTTGCCCTTCTCTCTCCTACGG + Intergenic
1159969550 18:74632507-74632529 CCTGGCCCTGCTCTGCCTCCTGG - Exonic
1160427772 18:78790183-78790205 CCCAGCCCTGCTCCCTCCTGAGG + Intergenic
1160440000 18:78882560-78882582 CCAGGTCCTGCTGTCTCTGGTGG + Intergenic
1161451140 19:4346043-4346065 CCTGGCACAGCTCTCTCCGGAGG + Intronic
1161723643 19:5916635-5916657 CCTGGCCCTGGACTGTCCTGGGG + Exonic
1162746988 19:12804306-12804328 CCCGGCCCTGCTCTCTCACCCGG - Intronic
1162979514 19:14229595-14229617 CCAGGCCCTGACCTCTCTGGGGG + Intergenic
1163441466 19:17324368-17324390 CCTGCTCCAGCTCACTCTTGGGG - Intronic
1163756539 19:19109843-19109865 CTTCACCCTGCTCTGTCTTGCGG - Intronic
1165049139 19:33130614-33130636 CCTGGCTCTGCCCTCCCATGGGG - Intergenic
1166360639 19:42251600-42251622 CCTTGGCCTTCTCTCTCTAGTGG - Intronic
1166366860 19:42282201-42282223 TCTGGCCCTGCAGTCTCTGGAGG + Intronic
1166410949 19:42555109-42555131 CCTGGCCCTGCTTTCCCTCTGGG - Intronic
1167023735 19:46898940-46898962 CCTGTTACTGCTCTGTCTTGGGG - Intergenic
1167112280 19:47469474-47469496 CCTGGCTGTGGTCTCTCTTGAGG - Intronic
1167393259 19:49210837-49210859 CCAGGCCCCGCTCTCACTTCTGG - Exonic
1167551307 19:50162883-50162905 CCTGGCCCCGACCCCTCTTGGGG + Intronic
1167720024 19:51172890-51172912 CCTGACCCTGGTCATTCTTGCGG + Intergenic
1168725878 19:58581738-58581760 CCTCGCCCTGCTCCTGCTTGCGG - Intergenic
925222108 2:2150160-2150182 CCTGGCACTGATCTGTCTTGGGG + Intronic
926942714 2:18155064-18155086 CAGGGCCCTGCTCCCTCTGGAGG - Intronic
927216203 2:20669070-20669092 CCTCTCCCTCCTCCCTCTTGGGG + Intronic
927635772 2:24815454-24815476 CCTTGGCCTGCTGTCTATTGAGG + Intronic
928132965 2:28666739-28666761 CCTGCCCATGCTCTCCCTGGAGG - Intergenic
928644240 2:33335072-33335094 CATGGCACTGCTCTCTAGTGTGG + Intronic
929579157 2:43070830-43070852 CCAGGCCCCGCGCTTTCTTGGGG + Intergenic
931657704 2:64524771-64524793 CCCGGCTCTGCTCTCTTCTGCGG + Intronic
933816130 2:86070068-86070090 CCCGGCCCAGCTCACTCTGGGGG + Exonic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936092755 2:109511686-109511708 CCTGGCCCTGGTCTCACGTTGGG - Intergenic
936119996 2:109732965-109732987 CATGGCCCACCTCCCTCTTGGGG + Intergenic
936749187 2:115620142-115620164 CCTGGCCCAGCGCTCTGTTCGGG - Intronic
937036341 2:118785764-118785786 CCCAGCCCTGCTAACTCTTGGGG + Intergenic
937240836 2:120461384-120461406 CCTGTGCCTGCTGTCCCTTGGGG - Intergenic
937344240 2:121113929-121113951 CCTGGGCTTGCTGTCTTTTGAGG - Intergenic
937792779 2:125980059-125980081 CCTGGCCCTGCCCTCTGTGTGGG - Intergenic
938876072 2:135532081-135532103 CGTGGTACTGCTCTCTCGTGTGG + Intronic
940782501 2:157947630-157947652 ACTGGTTCTGCTCTGTCTTGTGG + Intronic
941572263 2:167186210-167186232 CCTGGCCCTGAACACTCTTGTGG + Intronic
943790188 2:191922644-191922666 CTTGCCCCTGCTCACTCTTTGGG + Intergenic
946339411 2:219058353-219058375 CCTGGCCCTGTCATCTCTGGCGG - Intronic
946623934 2:221591041-221591063 CCTGGCTCTTATCACTCTTGCGG - Intergenic
947563941 2:231181780-231181802 GCTGCCCCTGCTGGCTCTTGTGG - Intergenic
948439904 2:237979958-237979980 CCTGGTGGTGCTCTCTCTGGAGG + Intronic
948947924 2:241230677-241230699 CCATGCCCTGCTCTTTCTTCTGG + Intronic
1168889918 20:1288311-1288333 CCTGGCCCTGCTGTCTCTTTGGG - Intronic
1169047254 20:2543482-2543504 CCTGGCCATGCTGTTTATTGTGG - Intronic
1170677994 20:18499992-18500014 ACTCGCCCTGCTCTATCTAGTGG - Intergenic
1171463060 20:25309642-25309664 CCTGGCCCTGGGCCCCCTTGGGG - Intronic
1172286608 20:33745170-33745192 CCTGGCACTGTTCCCGCTTGTGG - Exonic
1172739770 20:37156971-37156993 CCTGGCCTTACTAACTCTTGAGG + Intronic
1173247249 20:41345217-41345239 CCTGGGCCTGCTATCTAATGAGG + Intronic
1173627845 20:44486899-44486921 CCTGGTTCTGCTCTCTCTACTGG - Intronic
1174176962 20:48651357-48651379 CCTGGCCCTGCCCTACCCTGGGG - Intronic
1174242872 20:49152280-49152302 CATTTCCCTGCTCTCTGTTGGGG - Intronic
1174257191 20:49265797-49265819 CCTGGCCCTACTCATTCTTCTGG - Intronic
1174420503 20:50396313-50396335 CCTGGCCCTGTCCTCTCTTAGGG - Intergenic
1174546778 20:51331570-51331592 GCTGGCCCTGCTTTCCCCTGGGG - Intergenic
1174946448 20:54991509-54991531 CCTTGACCTGCTCTCTCCTTAGG + Intergenic
1175327830 20:58142065-58142087 CCTGGCTCTGGTCTCTCATCAGG - Intergenic
1175490306 20:59376086-59376108 CATGGCCCTGCCCTCCCTGGCGG - Intergenic
1175941309 20:62538752-62538774 GCTGGCCCTGCCCTCACTCGGGG + Intergenic
1176079969 20:63267599-63267621 GCTGGCCGTGCTCCCTCTGGAGG + Intronic
1176592303 21:8657377-8657399 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1177534208 21:22403027-22403049 TCTCGCCCTGTTCTCTCTAGTGG - Intergenic
1178159991 21:29901171-29901193 CTTTGTCCTGCTTTCTCTTGTGG - Intronic
1178699361 21:34820157-34820179 CCCAGCCCTGCTCCCTGTTGGGG - Intronic
1179794522 21:43775256-43775278 CCTGGACCTGTTCTTGCTTGGGG + Intronic
1179838360 21:44052958-44052980 CCTTGCCCTGCTCTCTCTCCTGG + Intronic
1180127095 21:45800266-45800288 CCTGGACCTGCTGTCTCTGTGGG - Intronic
1180275154 22:10634506-10634528 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1181116383 22:20634729-20634751 CCTGCCCCTGCTCTGCTTTGTGG - Intergenic
1182145866 22:27996353-27996375 CCAGGCCCTGCTCTTTCTGCTGG - Intronic
1182285021 22:29241193-29241215 CCTGGCCCTGGTTCCTCTGGAGG + Intronic
1182338435 22:29600969-29600991 CCTGGCCCTGACCTCCCTTCTGG + Intergenic
1183290986 22:37002002-37002024 GGTGGCCCTGTTCTCTCTCGAGG + Exonic
1183362158 22:37388291-37388313 CCTGGCCGGGGTCTCTCCTGTGG + Intronic
1183366510 22:37409809-37409831 GCTGGCCCTGCACCCTCCTGCGG - Intronic
1183951053 22:41353398-41353420 CCTGGCCCTCGTATCTCCTGGGG + Intronic
1184471488 22:44698586-44698608 CCGGGCCCTCCTCTCACTTATGG - Intronic
1184712944 22:46263540-46263562 CCTGGGCCTGCACACACTTGGGG - Intergenic
1185276331 22:49951565-49951587 CTTGGCCCTGCCCTCCCCTGGGG - Intergenic
950053282 3:10007918-10007940 CCTGGTCCTGTTCTTTATTGGGG - Intronic
950293902 3:11811454-11811476 TCTGCCACTGCTTTCTCTTGAGG + Intronic
950428441 3:12937301-12937323 CCTGGCCCTGGTGCATCTTGAGG + Intronic
950868507 3:16209020-16209042 CTTGGCCCAGCTCTCTCATCAGG + Intronic
952815658 3:37445227-37445249 TCTGGCCCTGGCCTCTGTTGAGG - Intergenic
953788503 3:45929113-45929135 CCTGGCCATGGTCTCTTTGGGGG + Intronic
953904488 3:46861629-46861651 CCTGGCCCTGTGCTGTCCTGGGG - Intronic
954305110 3:49721532-49721554 CCTGGCCCTGGCCCTTCTTGAGG + Exonic
954638306 3:52083546-52083568 CCTGGCCTGGTTTTCTCTTGAGG + Intronic
955181678 3:56677810-56677832 CTTGGCCCTGTTGTCTCTAGAGG - Intronic
960503718 3:118467952-118467974 CCTGGCCCTGCCCTATCATTTGG - Intergenic
961558171 3:127710856-127710878 CCTGGCTCTGCTCCACCTTGGGG + Intronic
961650734 3:128415590-128415612 CCTTGCCCTGCTCTGTCTCCAGG + Intergenic
961861389 3:129919199-129919221 CCTGGTCCTGCTCTTTATTGGGG - Intergenic
961998047 3:131267592-131267614 CCTGACCTTTCTCTCTCTTCTGG + Intronic
964680071 3:159328681-159328703 CCTGGCCCACCTGCCTCTTGGGG - Intronic
967096353 3:186180498-186180520 TCTGGCCCAGGTCTCTCCTGTGG - Intronic
968298650 3:197596564-197596586 CCTGGCACTTCTCCCTGTTGCGG - Intergenic
968377047 4:52384-52406 GCAGCCCCTGCTCTCTCTAGGGG + Intergenic
968384254 4:122492-122514 GCAGCCCCTGCTCTCTCTAGGGG + Intergenic
968402038 4:306296-306318 GCAGCCCCTGCTCTCTCTAGGGG - Intergenic
968410349 4:385004-385026 GCAGCCCCTGCTCTCTCTAGAGG + Intergenic
968421606 4:489539-489561 GCAGCCCCTGCTCTCTCTAGGGG + Intronic
968698962 4:2045801-2045823 ACTGGCCCTGCCCACGCTTGTGG - Intergenic
969056025 4:4403330-4403352 CCGGGCCCTGCTCTGTCCGGAGG + Intronic
969231236 4:5833102-5833124 CCAGGCCATGCTCTCTCTGAAGG - Intronic
969778457 4:9377512-9377534 CCTGGACCAGCTATTTCTTGGGG + Intergenic
970907000 4:21227528-21227550 CATGGCTCTTCTCTCTTTTGTGG + Intronic
971302861 4:25456243-25456265 CCAGGCCCTGCTCCCTCTCTTGG + Intergenic
972551985 4:40142287-40142309 CATGGCCCTCCTCTCTCTGGCGG + Intronic
973050844 4:45594011-45594033 TCTGGCTCTGCTCTCTTCTGTGG - Intergenic
975992892 4:80279034-80279056 TCTGTCCCTGCTCCCTCCTGAGG + Intronic
976751217 4:88452814-88452836 TCTCGCCCTGCTTTGTCTTGTGG - Intergenic
980963326 4:139497947-139497969 CATGGTCCAGCTCCCTCTTGTGG - Intronic
981042783 4:140238582-140238604 GCTGGCCCTTCTGGCTCTTGGGG + Intergenic
981261722 4:142728754-142728776 CAGGGCCCTGCTCTCTCCGGAGG - Intronic
981541932 4:145854966-145854988 CCATGCCCTGTGCTCTCTTGAGG - Intronic
982776465 4:159446705-159446727 TTAGGCCCTGCTCTCTGTTGTGG - Intergenic
983641212 4:169945443-169945465 TCTGGCCCTGATCTCTCTCCAGG - Intergenic
984021266 4:174487269-174487291 CCTCCCCCTCCACTCTCTTGGGG + Intergenic
984025027 4:174532705-174532727 TCTTGCCCAGCTCTGTCTTGTGG - Intergenic
984313197 4:178090891-178090913 CCTTGCCCTGCTCTGGCTGGTGG - Intergenic
984514877 4:180725839-180725861 CCTGGCCCTGGTCATTCTTCAGG + Intergenic
984705045 4:182841465-182841487 CAGGGCCCTGCTCCCTCTGGAGG - Intergenic
984808403 4:183772353-183772375 CCTGTCCCTGGTCTGTCTGGTGG + Intergenic
985008619 4:185559873-185559895 CCTAGCCCTGCCCTCACCTGAGG - Intergenic
985685568 5:1279905-1279927 CCTGGCCCGGCTGCTTCTTGTGG + Intronic
986273748 5:6255912-6255934 CCTGCACCTGCTCACTCCTGAGG + Intergenic
986604995 5:9514021-9514043 CGAGGCCCTGCTCCCTCTGGAGG + Intronic
987292169 5:16519647-16519669 CCTGCCCCTGAGCTCTCCTGTGG + Intronic
988067867 5:26245483-26245505 CATGGTCATGCTCTCTCTGGAGG + Intergenic
993155028 5:84211717-84211739 CCAGGCCATGCTCTCTCTGAGGG - Intronic
993201172 5:84817144-84817166 CCTGGCCCTTCCCACTTTTGCGG - Intergenic
994732753 5:103513137-103513159 TCTAGCCCTGGTCTCTCTTTGGG - Intergenic
997964866 5:138348823-138348845 CCTGGCTCTTCTCCCTCTTCAGG + Exonic
998192978 5:140042700-140042722 CCTGGTCCTGCACTGACTTGAGG + Exonic
998256366 5:140591710-140591732 CCAGGACCTGCTCTCTCCAGGGG - Intronic
999268861 5:150284741-150284763 CCTGGGCCCTCTCTCTCCTGTGG + Intronic
1000045302 5:157517328-157517350 ACTGGCCTTGGTCTCTCCTGAGG - Intronic
1000244061 5:159434391-159434413 CAGGGCCATGCTCTCTCTAGAGG - Intergenic
1000681547 5:164191140-164191162 CTGGTCCCTGCTCTCTCTTTAGG + Intergenic
1000698439 5:164418661-164418683 TCTAGCCCTGCTCTATCTAGTGG + Intergenic
1001686629 5:173598515-173598537 GCTGGCCCTGCTCCCTCGGGGGG + Intergenic
1002933541 6:1651608-1651630 CCTGGCCCTCATCTCTGTTCTGG + Intronic
1005073820 6:21887918-21887940 CTTGGCCCTGCTGTTTCATGTGG + Intergenic
1006223726 6:32518589-32518611 GCTGGGCCTGCTCTTCCTTGGGG - Exonic
1006230322 6:32580779-32580801 GCTGGGCCTGCTCTTCCTTGGGG - Exonic
1006672032 6:35735588-35735610 CCTGGCCCTGATCCCTTTTTGGG - Intergenic
1006728812 6:36219561-36219583 CCTGGCCTTGCTTGCTCTTGTGG - Intronic
1006776735 6:36598910-36598932 CGTGGCCCACCTCCCTCTTGGGG + Exonic
1006794650 6:36723979-36724001 CCTGCCCCAGGCCTCTCTTGTGG - Intronic
1006945179 6:37779852-37779874 CCTGTCCCTGCTCTCTCACCTGG + Intergenic
1006985099 6:38170634-38170656 CCTTGCCCTTCCCTCTCTTCTGG + Exonic
1009230308 6:61053372-61053394 CCTTGCCCTGCTTTGGCTTGTGG + Intergenic
1010969828 6:82251531-82251553 CCTCACCCTGCTTTCTTTTGGGG - Intergenic
1011481038 6:87794438-87794460 CCTGGTTCTTGTCTCTCTTGAGG + Intergenic
1012804387 6:103876475-103876497 CCTGCCCCTGCTTTTTCTTAAGG - Intergenic
1013111847 6:107070521-107070543 GGTGGACCTGCTCTCCCTTGAGG - Exonic
1013141827 6:107344538-107344560 CTTGGCCCTGCTGTCCCTCGAGG - Intronic
1013587238 6:111590606-111590628 CCAGGCTCTTCTCTCTCTTGGGG - Intronic
1017101464 6:150852985-150853007 CCTGAGCCTTCTCTGTCTTGCGG - Intergenic
1017760373 6:157563398-157563420 CCTTGCCCTGCTCTGACTTGGGG + Intronic
1017792719 6:157815505-157815527 CCTGGCCCAGGGCTCTCTTAGGG + Intronic
1018392242 6:163349537-163349559 CCAGGCCCTGGTCTCTCTGGGGG + Intergenic
1019732268 7:2634681-2634703 CCTGGCCCTGGTCCCTCCGGGGG - Intronic
1020210441 7:6154448-6154470 CTTGCTCCTGCTCTCTCTGGCGG - Exonic
1020457901 7:8395033-8395055 CCTGGCCCTTCTTTTTGTTGTGG + Intergenic
1022856380 7:34318896-34318918 CCTGGTCTTGCTCTTTCATGTGG + Intergenic
1023818616 7:43968293-43968315 CCTGGCCCTCCCCTCTCTCCAGG - Intergenic
1023868468 7:44250107-44250129 CCTGGCCCAGCGTTGTCTTGGGG - Intronic
1024004133 7:45212806-45212828 CCAGGCCCCGCCCTCTCCTGGGG + Intergenic
1024669912 7:51585043-51585065 CCTGCACCTGTTCTCTCTGGTGG - Intergenic
1025250479 7:57348189-57348211 CCTGGCCCTGTCCTGTCTTAGGG + Intergenic
1026896768 7:74013921-74013943 CCTGGACCAGCTCGCTCCTGCGG - Intergenic
1027138093 7:75638884-75638906 CCTGGCCCGGCTCCCTCCTCCGG + Intronic
1027202410 7:76072270-76072292 CCAGGCCCAGCACTCTCTCGCGG - Intergenic
1027202711 7:76073450-76073472 CCAGGCCCAGCGCTCTCTCGCGG - Intergenic
1029295673 7:99538526-99538548 CCTGGCACTGCTGTCTCTTTAGG + Intergenic
1029595287 7:101534339-101534361 CCTGGCCCTGCTCTCTTCTAGGG - Intronic
1029743665 7:102505258-102505280 CCTGGCCCTCCCCTCTCTCCAGG - Intronic
1029761651 7:102604421-102604443 CCTGGCCCTCCCCTCTCTCCAGG - Intronic
1030086447 7:105819756-105819778 CCCGGCCTTGCTTTGTCTTGTGG - Intronic
1031135893 7:117883448-117883470 CGTGGCCCACCTCCCTCTTGGGG + Intergenic
1032508552 7:132454016-132454038 CTTGTCCCTGCTCTCTGGTGTGG + Intronic
1034441283 7:151087149-151087171 CCTGGCCATGCTCTCCCTGTCGG + Intronic
1034498752 7:151436908-151436930 GCTGGCCCTCCTCTGTCTTTTGG - Intronic
1035550190 8:517293-517315 CCCTGCCCAGCTGTCTCTTGTGG + Intronic
1036275905 8:7351508-7351530 CCTGGACCAGCTATTTCTTGGGG + Intergenic
1036440891 8:8780946-8780968 CCTGCTGCTGCTCACTCTTGGGG - Intergenic
1036634521 8:10539906-10539928 CTTGGGCCTTCTCTCTTTTGAGG + Intronic
1036679151 8:10857987-10858009 CCTGGCCTTTCTTTCTCTGGTGG + Intergenic
1036840779 8:12119605-12119627 CCTGGACCAGCTATTTCTTGGGG - Intergenic
1036862583 8:12365855-12365877 CCTGGACCAGCTATTTCTTGGGG - Intergenic
1037174737 8:15933244-15933266 CCTGGCAAAGCTGTCTCTTGTGG - Intergenic
1038438925 8:27558320-27558342 CCTTGCCCTATTCTCTCCTGAGG + Intergenic
1038611966 8:29066674-29066696 CCTGGCCCTGCTCTCTGATGAGG - Intergenic
1039478284 8:37853090-37853112 CCTGGCCATGCTCTGCCCTGAGG - Intergenic
1040018931 8:42722857-42722879 CCTTGCCCAGCTCCCTCTTGGGG + Intronic
1040060938 8:43102344-43102366 CACGGCCCTGCTCTGTCCTGGGG + Intronic
1041047042 8:53897338-53897360 TAAGGCCCTGCTCTCACTTGTGG + Intronic
1041224539 8:55685386-55685408 CCTGACCGTGCTCTCTGCTGAGG - Intergenic
1041914661 8:63126930-63126952 CCTGCCACTGCTCACTCTTTGGG + Intergenic
1042837634 8:73092619-73092641 CCGGGCTCTGGTCTGTCTTGGGG + Intronic
1043439632 8:80265846-80265868 CCTGGCCCCGCTTGGTCTTGTGG + Intergenic
1043684968 8:83073285-83073307 TCTTGCCCTGCTCTGTCTAGTGG - Intergenic
1044293844 8:90504306-90504328 CCTGCCCTTTCTTTCTCTTGAGG - Intergenic
1044406623 8:91834180-91834202 GCTGGACTTGTTCTCTCTTGGGG - Intergenic
1044622579 8:94204776-94204798 CCTTCCCTTGCTCTGTCTTGGGG - Intronic
1044728150 8:95209387-95209409 CCTGGGGCTGCTCCCTCCTGAGG + Intergenic
1044899417 8:96927941-96927963 CCTTGCCCTGCTTTATCCTGTGG + Intronic
1045650661 8:104338987-104339009 CCTGACCCTTCCCTCCCTTGGGG + Intronic
1045872070 8:106938561-106938583 CCTGTCCCTGCTCTCATTAGAGG - Intergenic
1046523627 8:115357084-115357106 CCTCGTCCTGCTCTCTAGTGGGG - Intergenic
1046996987 8:120534451-120534473 CCTCGCACTGCTCTGTCTAGTGG - Intronic
1047283293 8:123464495-123464517 CCTGGCAATGCTCTCTCCAGTGG - Intronic
1048330860 8:133469946-133469968 CCTGGCCCTGCACTCACTCTGGG - Intronic
1048999289 8:139814435-139814457 CCTGGGCCTGCTCTTGCCTGAGG - Intronic
1049610439 8:143552683-143552705 CCTGCCTCTCCTCACTCTTGGGG + Intergenic
1049711031 8:144063388-144063410 CCCAGCCCTGCGCTCTCTGGTGG - Intronic
1052865140 9:33460301-33460323 CCTGGCCCTGCCACCTCATGTGG - Intergenic
1053287947 9:36861988-36862010 CCTGGCCCTTCCCAGTCTTGTGG - Intronic
1053366249 9:37524516-37524538 CCTGGCTCTGCTCTGTGCTGAGG + Intronic
1054818406 9:69497662-69497684 CATGGACCTGCTCTTTCTTCAGG + Intronic
1056234125 9:84574724-84574746 CCAGGCCCTGCTCTCTTTAAGGG + Intergenic
1056659112 9:88531969-88531991 CAGGGCCCTGCACTCACTTGGGG - Intergenic
1056756926 9:89387480-89387502 CCTGGGCCTGTTGTCTATTGGGG + Exonic
1057785463 9:98084143-98084165 CCTGACTCTTCTGTCTCTTGAGG - Intronic
1057785857 9:98087031-98087053 CCTGACTCTTCTGTCTCTTGAGG - Exonic
1057948860 9:99353762-99353784 ACTGGCCCTCCTTTCTCTTGGGG + Intergenic
1059436832 9:114282255-114282277 TCTGTCCCTCCTCTCTCTTCAGG + Exonic
1059757306 9:117305450-117305472 CCTGGCCCTGTGCTATATTGGGG - Intronic
1060611721 9:124972368-124972390 TCTGGCACTGCTCTGTCTTGCGG + Intronic
1060730393 9:126033458-126033480 CCTGCCCCTGCAGGCTCTTGGGG - Intergenic
1061097822 9:128470102-128470124 AGTTGCCGTGCTCTCTCTTGGGG + Intronic
1061995610 9:134181312-134181334 CCTCTCCCTGCTCTCTCTGATGG - Intergenic
1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG + Intronic
1062276820 9:135735327-135735349 CAGGGCCCTGCTCCCTCTGGGGG - Intronic
1062330323 9:136039828-136039850 CTTTGCCATGCTCTCTCTCGGGG - Intronic
1062397803 9:136359416-136359438 CCTGTCCCTGCTCTCGGGTGCGG - Exonic
1062479362 9:136744298-136744320 CCTCACCCTGGGCTCTCTTGGGG - Intronic
1203572190 Un_KI270744v1:141862-141884 GCAGCCCCTGCTCTCTCTAGGGG - Intergenic
1203622357 Un_KI270749v1:136224-136246 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1186772973 X:12836138-12836160 TCTGTCCCTGCTTTCTTTTGTGG + Intergenic
1188210479 X:27418451-27418473 TCTTGCTCTGCCCTCTCTTGTGG - Intergenic
1189659183 X:43278851-43278873 CCTGGACCTGCTCACTCAGGCGG - Intergenic
1189905311 X:45753436-45753458 CCTGGCTCTTTTCTCACTTGCGG - Intergenic
1192487737 X:71544770-71544792 CCTGGCCCTGCTCTATTCTGAGG - Intronic
1193467920 X:81869393-81869415 CCTGGCCCAGCTCCACCTTGGGG + Intergenic
1193945821 X:87732908-87732930 ACTGGCCTTGCACTCTCTTTTGG - Intergenic
1194128618 X:90051176-90051198 CCTGGCCCAGCTCTATCTCCTGG + Intergenic
1198167172 X:134069357-134069379 CATGGCCATGCTCTCTCTGAAGG - Intergenic
1199165784 X:144673315-144673337 CCAGGCCCTGCTCCCTCCAGAGG + Intergenic
1200140234 X:153897435-153897457 CCTGGCCCAGGTCTTTCATGTGG + Intronic
1201354745 Y:13084889-13084911 TCTTGCCCTGCTCTGTCTAGTGG + Intergenic
1201486975 Y:14505309-14505331 CCTGGCTCTTCTCCCTCTGGAGG - Intergenic