ID: 1121504898

View in Genome Browser
Species Human (GRCh38)
Location 14:94469585-94469607
Sequence CCTGGCCATGCTCTCCCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 6, 3: 23, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121504898_1121504908 21 Left 1121504898 14:94469585-94469607 CCCCAAGGGAGAGCATGGCCAGG 0: 1
1: 1
2: 6
3: 23
4: 238
Right 1121504908 14:94469629-94469651 GAGAAGAAGATGTTCTGACTCGG 0: 1
1: 0
2: 1
3: 18
4: 202
1121504898_1121504907 -1 Left 1121504898 14:94469585-94469607 CCCCAAGGGAGAGCATGGCCAGG 0: 1
1: 1
2: 6
3: 23
4: 238
Right 1121504907 14:94469607-94469629 GGAAGTGGAGACACTCACAGGGG 0: 1
1: 0
2: 2
3: 23
4: 261
1121504898_1121504910 23 Left 1121504898 14:94469585-94469607 CCCCAAGGGAGAGCATGGCCAGG 0: 1
1: 1
2: 6
3: 23
4: 238
Right 1121504910 14:94469631-94469653 GAAGAAGATGTTCTGACTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1121504898_1121504906 -2 Left 1121504898 14:94469585-94469607 CCCCAAGGGAGAGCATGGCCAGG 0: 1
1: 1
2: 6
3: 23
4: 238
Right 1121504906 14:94469606-94469628 GGGAAGTGGAGACACTCACAGGG 0: 1
1: 0
2: 2
3: 22
4: 240
1121504898_1121504909 22 Left 1121504898 14:94469585-94469607 CCCCAAGGGAGAGCATGGCCAGG 0: 1
1: 1
2: 6
3: 23
4: 238
Right 1121504909 14:94469630-94469652 AGAAGAAGATGTTCTGACTCGGG 0: 1
1: 0
2: 4
3: 26
4: 244
1121504898_1121504905 -3 Left 1121504898 14:94469585-94469607 CCCCAAGGGAGAGCATGGCCAGG 0: 1
1: 1
2: 6
3: 23
4: 238
Right 1121504905 14:94469605-94469627 AGGGAAGTGGAGACACTCACAGG 0: 1
1: 0
2: 5
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121504898 Original CRISPR CCTGGCCATGCTCTCCCTTG GGG (reversed) Exonic
900339420 1:2181028-2181050 CCTGACCATGCTCTGCCATGCGG + Intronic
900829561 1:4956197-4956219 TTTGGCCCTGCTCTCCCTTAAGG - Intergenic
901102377 1:6728733-6728755 CAAGGCCATGCTTTCCCTGGTGG - Intergenic
902391435 1:16109408-16109430 CCTTGTCTTGCTGTCCCTTGAGG - Intergenic
902631355 1:17706440-17706462 CCTGACCCTGCTCTCCCATGGGG + Intergenic
902717611 1:18283306-18283328 GCAGTCCCTGCTCTCCCTTGTGG - Intronic
904371565 1:30050770-30050792 CTCAGCCATGCTCTCCCTTCTGG - Intergenic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
905205401 1:36340412-36340434 CCTGGCCCTGCTCCCCAGTGGGG - Exonic
905759403 1:40541643-40541665 CTTGTCCTTGCTCTACCTTGAGG - Exonic
906227346 1:44132783-44132805 TCTTTCCTTGCTCTCCCTTGGGG + Intronic
908116906 1:60949632-60949654 CATGGCCCAGCTCTCCCATGCGG + Intronic
908252896 1:62279104-62279126 ACTTGCCCTCCTCTCCCTTGTGG - Intronic
912253174 1:108031900-108031922 CCTTTTCATGCTCTCCCTTCTGG - Intergenic
915600529 1:156920542-156920564 CCTCGCCTTGCTCTGCCCTGCGG + Intergenic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
917972422 1:180217294-180217316 CCAGCCCAGGGTCTCCCTTGAGG - Intergenic
918302657 1:183218243-183218265 CCTAGCCATCCTCGCCCGTGCGG - Intronic
920005854 1:202833422-202833444 CCTGGCCAAGCCCTCACATGCGG + Intergenic
920414971 1:205793116-205793138 CCTGGCCATGCTCTTTATTTGGG - Intronic
921047037 1:211485051-211485073 TCTGGCCTTACTCTGCCTTGAGG - Intronic
921776093 1:219101920-219101942 CCTGGCAAAGCTCTCTCGTGGGG + Intergenic
922697697 1:227739803-227739825 CCTGGCCATGACCTCCCTCGAGG + Intronic
923092460 1:230750791-230750813 CCTTGCCCTGGGCTCCCTTGAGG - Intronic
1062798110 10:359245-359267 GGTGGCCCTGCTCTCCCTGGGGG - Intronic
1062845116 10:697551-697573 CCTGGCCACGCTTTCCCATCTGG - Intergenic
1065263643 10:23952566-23952588 CCTGGCCATTTTCTCCATTTAGG + Intronic
1066613571 10:37275403-37275425 CCTTGCCATGGGCTCCCATGCGG - Intronic
1067539342 10:47140399-47140421 TCTGGCCCTGCTCTCCCCAGTGG - Intergenic
1069817916 10:71210273-71210295 CCGGGCCCTGCTCTCCCTCCAGG - Intergenic
1070306005 10:75239570-75239592 CCTGCCCATTCCCTCCCCTGGGG - Intergenic
1070399046 10:76036651-76036673 CCTGGCTATGCCCTCACTGGGGG + Intronic
1071770756 10:88726882-88726904 CCTGGGCATCCTCTTCCATGTGG - Exonic
1072806926 10:98429694-98429716 CCTGTCCCTGCTCTCCCAGGAGG + Intronic
1075626476 10:123967602-123967624 CCTGGCCAAGTTGTCCCTTGAGG - Intergenic
1075800861 10:125152328-125152350 CCTGGCCGCGCTCTACCTGGAGG - Intronic
1076655966 10:132023586-132023608 CCTGGCCCTGCTGCCCCTTCTGG - Intergenic
1077046777 11:550206-550228 CCTGGCCATGCTCACCCTGGAGG + Exonic
1077296050 11:1826765-1826787 CCTGGCAGTGCGCTCCCTGGAGG - Intergenic
1077549609 11:3194236-3194258 CCTGGAGATGCCCTCCCTTCTGG - Intergenic
1078157796 11:8813749-8813771 GCGGGCCATGCTCCCCCTAGTGG + Intronic
1079007268 11:16800803-16800825 CCACCCCAAGCTCTCCCTTGAGG - Intronic
1079911437 11:26315454-26315476 GCAGTCCATGCTATCCCTTGGGG + Intronic
1081774919 11:45670419-45670441 CATTGCCATACTCTCCCCTGTGG + Intergenic
1081808780 11:45903826-45903848 CTTGACCTTGCTCTCCCCTGGGG + Intronic
1081991402 11:47339515-47339537 CCTGACCAGTCTCTCCCATGGGG + Intronic
1082997171 11:59263529-59263551 CCTGGCCATGGTGGCCCATGAGG - Intergenic
1084269334 11:68020779-68020801 CCTGGCATTTCTCCCCCTTGTGG - Intronic
1084303803 11:68268183-68268205 CCGGGCCATGCCATCCTTTGTGG + Exonic
1084484099 11:69438055-69438077 CCACGCCAGGCTCTCCCTAGTGG - Intergenic
1085034365 11:73291293-73291315 CCTTGCCCTGCCCTGCCTTGGGG + Intronic
1085270763 11:75268678-75268700 CCTGGCCTCCCTCTCCCATGGGG + Intronic
1087338016 11:96868057-96868079 ACTGGCCATGTTGTCACTTGTGG + Intergenic
1090201474 11:124860879-124860901 CTGGGCCATGCTCTCCCTGAAGG - Intergenic
1092849283 12:12612133-12612155 CCTGGCCAGGCACTCCCTCCCGG - Exonic
1096809810 12:54162065-54162087 CTTTGCCATGTTCTCCCCTGTGG - Intergenic
1097848382 12:64389083-64389105 TCTCGCCAACCTCTCCCTTGGGG + Intronic
1100343222 12:93701483-93701505 CCAGGCCATCTTGTCCCTTGTGG + Intronic
1101319362 12:103659685-103659707 CCTGTCTATGGTCTCCTTTGTGG + Intronic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG + Intergenic
1108218954 13:48213728-48213750 CCTGGCCATGTTCTCTTTTATGG + Intergenic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1116466333 14:45237171-45237193 CCTGGTGATGCTCTCACTTTAGG + Intronic
1118001247 14:61525902-61525924 CCCGGCCGTGCTCTCTCCTGGGG + Intronic
1118309747 14:64683556-64683578 CCTGGCCATGCTTGCCATCGTGG - Intergenic
1119041973 14:71282577-71282599 TCTGGCCTTGCTCTCTCCTGGGG - Intergenic
1119325620 14:73758473-73758495 CCTGGCCAGGCTCCCCCTGCTGG + Intronic
1119516944 14:75255736-75255758 CTTTGCCATTCTCTCTCTTGAGG - Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1121511295 14:94515101-94515123 CGTGGCCGTGCTGGCCCTTGGGG - Intronic
1121521263 14:94587587-94587609 CCTGGCCATGCTCTCCCTGGGGG + Exonic
1121670148 14:95702879-95702901 CCTGGCCATGTTCAGCCTTTGGG + Intergenic
1122401461 14:101469829-101469851 CCTGGCCTTGCTCTTGCTTCAGG - Intergenic
1202930291 14_KI270725v1_random:28795-28817 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1128514136 15:68331705-68331727 CCTGGCCATGCTTCCCCAAGTGG - Intronic
1130064352 15:80592143-80592165 CCTGGCTCTGCTCTCCTCTGTGG + Intronic
1131046273 15:89318494-89318516 CCTGGCCATGTGCTCCTATGTGG - Intronic
1131434280 15:92410906-92410928 CCTGGCCATTCTCTCCATCTAGG - Intronic
1132319840 15:100918109-100918131 CCTGGGCCTGCGCTCCCTCGCGG + Intergenic
1132670130 16:1099090-1099112 CCTGGCCATGGTGTCCCAGGTGG + Intergenic
1132896847 16:2233298-2233320 ACTGGCCCTGCTCTCCCTGTGGG - Intronic
1132905612 16:2281170-2281192 CGTGGACAGGCTCTCCCTCGCGG - Exonic
1133240779 16:4413066-4413088 CCTGGCCATGCTCTTGCCTGTGG + Intronic
1133299955 16:4776416-4776438 GCTGGCCATGCTGGCCCCTGGGG + Intergenic
1133530533 16:6651259-6651281 CCTGGCCATGCTCTCCATGGAGG - Intronic
1134290968 16:12902606-12902628 CCTGGACATGTGCTCCCTTTGGG - Exonic
1135875471 16:26196041-26196063 CCTGGAAATGCTGTCTCTTGAGG + Intergenic
1137554792 16:49463713-49463735 CCTGGCCATGCTCCCCAAGGGGG + Intergenic
1137783137 16:51114569-51114591 ACTGGCCATGCTCTTCCTCTGGG - Intergenic
1138458039 16:57132535-57132557 CCTGGCCTGGCTCAGCCTTGAGG - Intronic
1139658846 16:68406391-68406413 CCTGGCCCTCCTCTTCCTTGGGG + Intronic
1140469919 16:75208129-75208151 CCCGCCCATGCTCTGCCCTGAGG - Intergenic
1140488989 16:75318264-75318286 CCTGGCCATGTTGTCCCTGATGG - Intronic
1141690667 16:85594413-85594435 CCTGGCCAGGGCCTTCCTTGGGG + Intergenic
1143251785 17:5528212-5528234 CCTGGCCACGGTCTCACTTGTGG + Intronic
1143525243 17:7468073-7468095 CCTGGCCTTGCTCTTCCCTCTGG - Intronic
1145271153 17:21405610-21405632 CCAGGCCCTGCCCTCCCCTGCGG + Intronic
1145309357 17:21692997-21693019 CCAGGCCCTGCCCTCCCCTGCGG + Intronic
1146532542 17:33621628-33621650 CCTGGCCAGGCTGTGCCTTGGGG + Intronic
1147248550 17:39138662-39138684 CCTGCCCCTCCTCTCCCCTGGGG - Intronic
1148368608 17:47076034-47076056 CAGGGCCATGCTCTCTCTGGAGG - Intergenic
1151890147 17:76946916-76946938 CCTGCCCAGGCGCTCCCTCGGGG - Intronic
1152263441 17:79279453-79279475 CCGGGCCATGCTGTGCCGTGAGG - Intronic
1152339564 17:79716613-79716635 CCTGGCCATGCTGAGCCATGTGG + Intergenic
1152397986 17:80046723-80046745 CCTGGCCAGGGTCTCCCAAGAGG + Intronic
1153086662 18:1296414-1296436 CATCTCTATGCTCTCCCTTGAGG - Intergenic
1153618371 18:6954235-6954257 CTTGGCCTTGGTCTCCCGTGTGG + Intronic
1155317970 18:24591134-24591156 CCGGGCCAATCTCTCCCCTGGGG + Intergenic
1157006567 18:43590258-43590280 CCTGGCCCAGCTCCTCCTTGGGG + Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1157446214 18:47748572-47748594 CCTGGCCATGCAGTGCCATGTGG - Intergenic
1159103277 18:63978422-63978444 CCTGGCCATGGTCTTCATGGGGG + Exonic
1159922343 18:74237456-74237478 CCTGGCCTTCCTCTGCCCTGGGG + Intergenic
1159946131 18:74446041-74446063 CCTGGCAGGGCTTTCCCTTGTGG + Intronic
1159969550 18:74632507-74632529 CCTGGCCCTGCTCTGCCTCCTGG - Exonic
1161077106 19:2291134-2291156 CCTGGCCATCGCCTCCCTGGAGG - Exonic
1161519157 19:4713942-4713964 CCTGGGCATGCTGTCCTTCGAGG - Intronic
1162548740 19:11346603-11346625 CCTGTTCATGCTCTCCCATCAGG - Exonic
1163212529 19:15851825-15851847 CTTGGCCATGCTCCTGCTTGAGG - Intergenic
1163799247 19:19355001-19355023 GCTGGCCATGGGCTCCCTGGAGG + Intronic
1164476954 19:28582996-28583018 CGTGACCATGCTCTTCCTTTTGG + Intergenic
1164724588 19:30457639-30457661 CCTGACCATGCTGTCCTTGGAGG + Intronic
1165015981 19:32880179-32880201 CCTGGCCATGCTCCCCGATGGGG - Intronic
1165049139 19:33130614-33130636 CCTGGCTCTGCCCTCCCATGGGG - Intergenic
1165964349 19:39563008-39563030 TCTGGCCATACTCTTCATTGTGG - Intergenic
1166410949 19:42555109-42555131 CCTGGCCCTGCTTTCCCTCTGGG - Intronic
1167112280 19:47469474-47469496 CCTGGCTGTGGTCTCTCTTGAGG - Intronic
1168315518 19:55483245-55483267 CCAGGCCACGCTCTCCCTCGAGG + Exonic
928132965 2:28666739-28666761 CCTGCCCATGCTCTCCCTGGAGG - Intergenic
933141394 2:78795424-78795446 CCTCTGCATGCTCTCCCTAGGGG - Intergenic
934115329 2:88785239-88785261 CCTGACAATCCTCTTCCTTGAGG - Intergenic
934631319 2:95926755-95926777 CCTGACAATCCTCTTCCTTGAGG + Intronic
934802720 2:97182229-97182251 CCTGACAATCCTCTTCCTTGAGG - Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936076548 2:109405079-109405101 CCTGGGCATACTCACCCATGGGG + Intronic
936965511 2:118124063-118124085 AATGGCCATCCTCTCCCCTGAGG + Intergenic
937240836 2:120461384-120461406 CCTGTGCCTGCTGTCCCTTGGGG - Intergenic
938163791 2:129009169-129009191 CCTGGCCTGCCTCTCCCTGGAGG - Intergenic
938708940 2:133958665-133958687 CCTGTCCAGGCCCTCCCTTGGGG - Intergenic
945010981 2:205463357-205463379 CCTGGCCAGGCACTGCCTTGCGG + Intronic
946230659 2:218289344-218289366 CCTGGCCATTCTTTCATTTGAGG - Intronic
948264411 2:236626636-236626658 CCTGGCCAGGCTGTTCCCTGAGG - Intergenic
948281213 2:236749202-236749224 CTGGGACATGCTCTCCCTTCTGG - Intergenic
948896213 2:240928995-240929017 CCTGGCCATGCACCCGCTGGAGG - Intronic
1168889918 20:1288311-1288333 CCTGGCCCTGCTGTCTCTTTGGG - Intronic
1169047254 20:2543482-2543504 CCTGGCCATGCTGTTTATTGTGG - Intronic
1169263862 20:4155946-4155968 CTTGGCCTTGCCCTCCTTTGAGG - Intronic
1171296536 20:24021879-24021901 GCTGGGCAAGTTCTCCCTTGAGG + Intergenic
1171463060 20:25309642-25309664 CCTGGCCCTGGGCCCCCTTGGGG - Intronic
1174176962 20:48651357-48651379 CCTGGCCCTGCCCTACCCTGGGG - Intronic
1174546778 20:51331570-51331592 GCTGGCCCTGCTTTCCCCTGGGG - Intergenic
1174578771 20:51556196-51556218 CAGGGCCATGCTCTCCCTGAAGG - Intronic
1174677398 20:52371751-52371773 CATGGCCATGCCTTCCCTTAGGG + Intergenic
1175166650 20:57048842-57048864 GCTGGCCATGATCTCCCTGATGG - Intergenic
1175490306 20:59376086-59376108 CATGGCCCTGCCCTCCCTGGCGG - Intergenic
1176146633 20:63568407-63568429 GCTGGCCATGGCCTCCCTGGAGG - Exonic
1176592303 21:8657377-8657399 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1178213791 21:30569544-30569566 CCTCTGCATGCTCCCCCTTGGGG + Intergenic
1180275154 22:10634506-10634528 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1180980746 22:19876959-19876981 CCTGGCCATGGGCTCCCTCCAGG - Intronic
1181116383 22:20634729-20634751 CCTGCCCCTGCTCTGCTTTGTGG - Intergenic
1181774122 22:25147537-25147559 CCTGGCCATGCCCTCCCCCTGGG + Intronic
1181863699 22:25839355-25839377 CCTGGCCGTGCTCACCCTGCAGG + Intronic
1182143939 22:27985191-27985213 GCCTGCCATGCTCTCCCTGGGGG - Intronic
1182338435 22:29600969-29600991 CCTGGCCCTGACCTCCCTTCTGG + Intergenic
1183394956 22:37566391-37566413 CCTGGGCAAGCTCTCGCCTGTGG + Exonic
1183434128 22:37783483-37783505 CCCCGCCATGAGCTCCCTTGTGG + Intergenic
1183473332 22:38021319-38021341 CTTTGCCAAGCTCTTCCTTGTGG + Intronic
1185276331 22:49951565-49951587 CTTGGCCCTGCCCTCCCCTGGGG - Intergenic
949893074 3:8747649-8747671 GCTGCCTGTGCTCTCCCTTGGGG + Intronic
952901726 3:38115614-38115636 CCTGGCCATGCCTGCCCCTGAGG + Intronic
953788503 3:45929113-45929135 CCTGGCCATGGTCTCTTTGGGGG + Intronic
953956462 3:47235602-47235624 CCTGGTCATCTTCTCCCTGGGGG + Exonic
954140469 3:48602451-48602473 CCTGGTCATGCTCTTCCTATTGG + Intronic
954421202 3:50419958-50419980 GCTGGCCACCCTCTCCCCTGTGG - Intronic
956595031 3:70958071-70958093 CCTTGGAAGGCTCTCCCTTGTGG - Intronic
958471153 3:94522401-94522423 CCTGGCAATTCACTCCCTTGGGG - Intergenic
959567528 3:107847934-107847956 CCTGGCCTTGCTCTGCTATGAGG - Intergenic
961558171 3:127710856-127710878 CCTGGCTCTGCTCCACCTTGGGG + Intronic
962825344 3:139095863-139095885 CCTGACCATGCTCTACCCTAAGG - Intronic
968532973 4:1104947-1104969 CCAGCCCAGGCTCTCCCTGGGGG - Intronic
969231236 4:5833102-5833124 CCAGGCCATGCTCTCTCTGAAGG - Intronic
969250901 4:5968129-5968151 CCTGGTCATGCTCTTCCTCCAGG + Intronic
971220711 4:24703734-24703756 CCTGGCCAAGCTCAACCTTTTGG - Intergenic
971376336 4:26058680-26058702 CCAGGGCATGCTCGCCCTTAGGG + Intergenic
975972501 4:80058435-80058457 CCTGGCCTTGTACTCCCTTCAGG + Intronic
986370225 5:7072860-7072882 CCTCTCCATGCTCTCCCTCATGG - Intergenic
987118934 5:14748394-14748416 CCTGTCCAGGCACTGCCTTGAGG - Intronic
988067867 5:26245483-26245505 CATGGTCATGCTCTCTCTGGAGG + Intergenic
991524981 5:67546456-67546478 CCTGGCCATGTTCACCCATCTGG + Intergenic
992121392 5:73596862-73596884 ACTTGACATGCTCCCCCTTGTGG + Intergenic
992457935 5:76933269-76933291 TCTTTCCATGCTATCCCTTGAGG - Intergenic
993155028 5:84211717-84211739 CCAGGCCATGCTCTCTCTGAGGG - Intronic
993902640 5:93595171-93595193 CCTGGCTTTGCTCCCCCTTATGG + Intergenic
995561324 5:113384825-113384847 CCTGGCCACACTTTCCCTGGGGG - Intronic
995836634 5:116406017-116406039 CCTGGCCATAATCTGCCTAGAGG - Intronic
997437503 5:133885721-133885743 CCTTGTCAAGCTCTCCCTAGGGG - Intergenic
998039774 5:138944790-138944812 CCTCGCCACCCTCTCCCTGGAGG + Intergenic
999552477 5:152704426-152704448 CCTGCCAACTCTCTCCCTTGTGG + Intergenic
1000244061 5:159434391-159434413 CAGGGCCATGCTCTCTCTAGAGG - Intergenic
1001287660 5:170435551-170435573 CCTTGCCATTCTCTCCCAGGAGG + Intronic
1001583489 5:172816758-172816780 CCTGGCCAGGCTCTGCCTCATGG - Intergenic
1002881563 6:1257004-1257026 GCTGGCCAGCCTGTCCCTTGGGG - Intergenic
1003072990 6:2959200-2959222 CCTGGCCATGGTCTACATGGGGG - Exonic
1003094525 6:3131897-3131919 CCTGGCGGTGCTCTCCCTCCTGG + Intronic
1003122559 6:3329996-3330018 CCCGGCCATCCTCTCCCAAGGGG + Intronic
1005651586 6:27890044-27890066 CCTGCACATGCTGTCCTTTGGGG - Intergenic
1006223726 6:32518589-32518611 GCTGGGCCTGCTCTTCCTTGGGG - Exonic
1006230322 6:32580779-32580801 GCTGGGCCTGCTCTTCCTTGGGG - Exonic
1006668805 6:35716895-35716917 CATGCCCATGCTCTCCCCTGTGG - Intronic
1006728812 6:36219561-36219583 CCTGGCCTTGCTTGCTCTTGTGG - Intronic
1007285374 6:40743803-40743825 CCTGGCCATCTACTCCCTTTTGG - Intergenic
1007606649 6:43122474-43122496 GCTGGCAAACCTCTCCCTTGGGG + Intronic
1008331812 6:50254587-50254609 CACTGCCATGCTCTCCCTTCAGG - Intergenic
1008759595 6:54837830-54837852 CCAGGCCATCTTCTTCCTTGGGG - Intergenic
1012616505 6:101284590-101284612 CCTGGTCATGCTCTGCTTTAGGG + Intergenic
1013111302 6:107067485-107067507 CCTGGCCACCCCCTGCCTTGGGG - Exonic
1013111847 6:107070521-107070543 GGTGGACCTGCTCTCCCTTGAGG - Exonic
1013141827 6:107344538-107344560 CTTGGCCCTGCTGTCCCTCGAGG - Intronic
1017760373 6:157563398-157563420 CCTTGCCCTGCTCTGACTTGGGG + Intronic
1017788041 6:157772570-157772592 TGTGGCCATGCTCTCCCCAGAGG - Intronic
1017927693 6:158924602-158924624 CCTGGCCATGCTTTGCCCTAGGG + Intergenic
1018127103 6:160692238-160692260 CCAGGCAGTTCTCTCCCTTGGGG + Intergenic
1018149457 6:160924841-160924863 CCAGGCAGTTCTCTCCCTTGGGG - Intergenic
1019067031 6:169311031-169311053 CCAGGCCATGGTCTTCCATGGGG + Intergenic
1019446941 7:1076286-1076308 CCTGGCCTGCCTCTCCCTGGTGG - Intronic
1019491259 7:1314636-1314658 CCTGGCCTTGCGCTGCCTGGAGG + Intergenic
1019516239 7:1441417-1441439 CCTGGCCATGATCACCCAGGGGG + Intronic
1022762037 7:33365557-33365579 CTTGGCCATGATTTCCCTGGTGG - Intronic
1022968897 7:35498910-35498932 CCTGTCCATGCTCTCCTGTGTGG - Intergenic
1023489147 7:40719392-40719414 CCTGACCATGGTCTCCCTCAGGG + Intronic
1028792050 7:94864646-94864668 CCTGGCCTTGCTCTTCCTGTTGG + Intergenic
1033155555 7:138954275-138954297 CCTGGGCAGGCACTCCCTTTGGG + Intronic
1033360732 7:140637414-140637436 CCTGGCCAGGCTCTTCCCTTTGG - Intronic
1034441283 7:151087149-151087171 CCTGGCCATGCTCTCCCTGTCGG + Intronic
1034491288 7:151394358-151394380 CCTGGCCTGGCTCTCCTATGGGG + Intronic
1035383904 7:158457823-158457845 CCAGGCCAGGCTCGCCCTGGAGG - Intronic
1036116634 8:5966843-5966865 CCTTGCCAGGCTTTCCCTTGTGG + Intergenic
1037174737 8:15933244-15933266 CCTGGCAAAGCTGTCTCTTGTGG - Intergenic
1037332038 8:17752614-17752636 CCTGACAATTCCCTCCCTTGTGG + Intronic
1038292276 8:26260538-26260560 CAAGGACATGCTCTCCCTGGAGG - Intergenic
1038611966 8:29066674-29066696 CCTGGCCCTGCTCTCTGATGAGG - Intergenic
1039478284 8:37853090-37853112 CCTGGCCATGCTCTGCCCTGAGG - Intergenic
1039903054 8:41766954-41766976 CCCGGCCAGGCTGTCCCCTGGGG + Intronic
1043454828 8:80402740-80402762 CCTGTCCATGGTCTACCTCGAGG + Intergenic
1045650661 8:104338987-104339009 CCTGACCCTTCCCTCCCTTGGGG + Intronic
1047283293 8:123464495-123464517 CCTGGCAATGCTCTCTCCAGTGG - Intronic
1048253347 8:132885790-132885812 CAGGGCCATGCTCTCCCTGAAGG + Intronic
1049364032 8:142227785-142227807 CCTGGCCATGCTGGCCCTGAAGG + Intronic
1049426914 8:142541814-142541836 CCTGGCCAGGGTCTCCCAGGAGG + Intronic
1050530759 9:6586995-6587017 TCTAGCCATGCTCTCCCCAGTGG + Intronic
1052915379 9:33921296-33921318 CCTGTTCATACTCTCCCTTAAGG + Intergenic
1058824814 9:108765774-108765796 ACTGGCCATGCTCTTCCTTCAGG - Intergenic
1058938341 9:109790169-109790191 CCTGTCCATCATTTCCCTTGTGG + Intronic
1059099207 9:111453517-111453539 CCTGCCCACCCTCCCCCTTGAGG + Intronic
1059336029 9:113568969-113568991 CCAGGACATGCTCTTCCTTCTGG + Intronic
1059495678 9:114707275-114707297 CCTGGCCATCTTGTCCCTTATGG + Intergenic
1059958709 9:119544612-119544634 CCTGGCCAGGCTCTCCCTGTGGG + Intergenic
1060053603 9:120394095-120394117 TCTGTCCATGCTCTTCCCTGAGG + Intronic
1060342417 9:122789130-122789152 CCTGGCCAACCTCTCCCTGCTGG + Exonic
1062330323 9:136039828-136039850 CTTTGCCATGCTCTCTCTCGGGG - Intronic
1203622357 Un_KI270749v1:136224-136246 CCTGGCCCTGCCCTCCCTTTGGG + Intergenic
1193467920 X:81869393-81869415 CCTGGCCCAGCTCCACCTTGGGG + Intergenic
1195585697 X:106563146-106563168 TTTGGCCATGCTTTCCCTTGAGG - Intergenic
1196117221 X:112010964-112010986 ACTGCTCATGCTCTCCCCTGAGG - Intronic
1198167172 X:134069357-134069379 CATGGCCATGCTCTCTCTGAAGG - Intergenic
1201152855 Y:11103246-11103268 CCTGGCGATGCTCTCCGTGTGGG - Intergenic