ID: 1121506547

View in Genome Browser
Species Human (GRCh38)
Location 14:94482056-94482078
Sequence CCTCTGTGCAGCCTCCGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121506547_1121506549 -5 Left 1121506547 14:94482056-94482078 CCTGCTCGGAGGCTGCACAGAGG No data
Right 1121506549 14:94482074-94482096 AGAGGTTTTCTGTATCGTGTAGG No data
1121506547_1121506550 4 Left 1121506547 14:94482056-94482078 CCTGCTCGGAGGCTGCACAGAGG No data
Right 1121506550 14:94482083-94482105 CTGTATCGTGTAGGTCAAACTGG No data
1121506547_1121506551 16 Left 1121506547 14:94482056-94482078 CCTGCTCGGAGGCTGCACAGAGG No data
Right 1121506551 14:94482095-94482117 GGTCAAACTGGACCACACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121506547 Original CRISPR CCTCTGTGCAGCCTCCGAGC AGG (reversed) Intergenic
No off target data available for this crispr