ID: 1121506551

View in Genome Browser
Species Human (GRCh38)
Location 14:94482095-94482117
Sequence GGTCAAACTGGACCACACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121506546_1121506551 17 Left 1121506546 14:94482055-94482077 CCCTGCTCGGAGGCTGCACAGAG No data
Right 1121506551 14:94482095-94482117 GGTCAAACTGGACCACACCAAGG No data
1121506545_1121506551 18 Left 1121506545 14:94482054-94482076 CCCCTGCTCGGAGGCTGCACAGA No data
Right 1121506551 14:94482095-94482117 GGTCAAACTGGACCACACCAAGG No data
1121506547_1121506551 16 Left 1121506547 14:94482056-94482078 CCTGCTCGGAGGCTGCACAGAGG No data
Right 1121506551 14:94482095-94482117 GGTCAAACTGGACCACACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121506551 Original CRISPR GGTCAAACTGGACCACACCA AGG Intergenic
No off target data available for this crispr