ID: 1121508022

View in Genome Browser
Species Human (GRCh38)
Location 14:94491248-94491270
Sequence ATGTACTAGCGGTATGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121508019_1121508022 -5 Left 1121508019 14:94491230-94491252 CCACTTAAGCCTACATACATGTA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1121508022 14:94491248-94491270 ATGTACTAGCGGTATGCAGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121508022 Original CRISPR ATGTACTAGCGGTATGCAGA AGG Intronic
907417391 1:54323886-54323908 ATGTACAAGCAGAATGCAGCAGG + Intronic
915045638 1:153012480-153012502 ATTGACTAGAGGAATGCAGAGGG - Intergenic
915893231 1:159790669-159790691 CTGTGCTAGAGGTATGCACATGG - Intergenic
917660049 1:177169417-177169439 AGATACTTGCAGTATGCAGAAGG + Intergenic
923097158 1:230784742-230784764 TTCTACTAGGGCTATGCAGATGG + Intronic
1064923971 10:20549957-20549979 ATGTAATAGGGGTATACTGAGGG + Intergenic
1068244173 10:54342539-54342561 ATCTACTAGCATAATGCAGAGGG + Intronic
1075312012 10:121422155-121422177 ATGTCCAACCGGTAGGCAGAAGG + Intergenic
1082058879 11:47843645-47843667 ATGTGCTATTGCTATGCAGAGGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088200091 11:107322737-107322759 AAACACTAGAGGTATGCAGAGGG - Intergenic
1090569050 11:128027605-128027627 AGGTACCATCGGTATTCAGATGG + Intergenic
1091428548 12:412873-412895 ATGGAGTAACGGTGTGCAGATGG - Intronic
1110477058 13:75928417-75928439 ATGTATTAGCGGCATGAAAATGG + Intergenic
1121508022 14:94491248-94491270 ATGTACTAGCGGTATGCAGAAGG + Intronic
1124110251 15:26778786-26778808 ATGTACTAGCAGTATGCAATTGG - Intronic
1136685944 16:31995021-31995043 ATGTAGGAGCGGGATGCGGACGG - Intergenic
1137524602 16:49223738-49223760 ATTTACTAGCAATAAGCAGAGGG + Intergenic
1145096750 17:20035578-20035600 ATGTACTAGCAATAAGCACATGG - Intronic
1153506375 18:5803597-5803619 ATCTACTAGGGTAATGCAGAGGG + Intergenic
1155015983 18:21840095-21840117 ATATACTAGCAATATGCAAATGG - Intronic
1160396273 18:78574553-78574575 ATCTGCTAGGGGAATGCAGAGGG + Intergenic
925794929 2:7531067-7531089 CTGTACTAGGGCAATGCAGAGGG - Intergenic
942920437 2:181366709-181366731 AAGTACTAGCGGTGTGAAGAAGG + Intergenic
943085438 2:183305348-183305370 AGGTACTGGGGGTAAGCAGACGG + Intergenic
945900689 2:215534231-215534253 CTCTACTAGCGCAATGCAGAGGG + Intergenic
947672376 2:231946463-231946485 ATGTCCTGGCGGTATGCACAGGG + Intergenic
948485572 2:238278810-238278832 ATGTACAAGTGGGATGGAGAGGG + Intronic
1171001863 20:21423210-21423232 CTCTACTAGAGGAATGCAGAGGG - Intergenic
1174546449 20:51328940-51328962 ATGTATCAGCTGTATGCAGTAGG - Intergenic
1176720842 21:10391281-10391303 ATGTACTGGAGGTCTGCAGCAGG + Intergenic
1180302032 22:11044074-11044096 ATGTACTGGAGGTCTGCAGCAGG + Intergenic
951553657 3:23899283-23899305 ATGTACTAGAGTTTTGAAGATGG + Intronic
956280197 3:67547686-67547708 ATGTCCTAGCCTTATGCAAAGGG + Intronic
962474886 3:135746791-135746813 ATGTACTATTGCTATGCAGTGGG - Intergenic
964523681 3:157594524-157594546 GGGTACTAGCGGCAAGCAGAAGG + Intronic
977460008 4:97313275-97313297 ATGTACTAGCAGTGAGCACATGG - Intronic
988872864 5:35410436-35410458 ATGTACTACAGGAATGCAAAGGG + Intergenic
991206025 5:64051243-64051265 AGGTGCCAGCGGAATGCAGAGGG - Intergenic
993143797 5:84069319-84069341 ATATGCTAAGGGTATGCAGAAGG + Intronic
995822064 5:116246772-116246794 ATTGGCTAGCCGTATGCAGAAGG + Intronic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
1015630966 6:135231448-135231470 ATGGACTAGGGGTCTGTAGAAGG - Intergenic
1018564947 6:165141473-165141495 ATGTCCTAGCTGCAGGCAGAAGG - Intergenic
1042193270 8:66209623-66209645 ATGGAGTAGAGGTTTGCAGATGG + Intergenic
1047719215 8:127623537-127623559 ATGTTCTAGAAGTATGCAGTCGG + Intergenic
1048327679 8:133451690-133451712 ATGGAGTAGCGGGCTGCAGATGG - Intergenic
1052321445 9:27171930-27171952 ATGTACTAGGTGTACTCAGAGGG + Intronic
1058486545 9:105447914-105447936 AGGCACTAGCGGTAGACAGACGG + Intronic
1193239213 X:79146844-79146866 ATCTATGAGCGGAATGCAGAAGG - Intergenic
1193733947 X:85134555-85134577 CTGTGCTAGAGATATGCAGAGGG + Intergenic
1200124457 X:153806730-153806752 ATGTCGGAGAGGTATGCAGACGG - Exonic