ID: 1121510459

View in Genome Browser
Species Human (GRCh38)
Location 14:94509410-94509432
Sequence CCGAAAAAGGACTAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121510459_1121510465 -1 Left 1121510459 14:94509410-94509432 CCAGCCTCCTAGTCCTTTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 142
Right 1121510465 14:94509432-94509454 GTCCTGGTCCTGCAGCCTTCAGG 0: 1
1: 0
2: 3
3: 30
4: 301
1121510459_1121510470 20 Left 1121510459 14:94509410-94509432 CCAGCCTCCTAGTCCTTTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 142
Right 1121510470 14:94509453-94509475 GGTTCCAGGTATGTTCCTCTAGG 0: 1
1: 0
2: 0
3: 14
4: 138
1121510459_1121510467 6 Left 1121510459 14:94509410-94509432 CCAGCCTCCTAGTCCTTTTTCGG 0: 1
1: 0
2: 0
3: 5
4: 142
Right 1121510467 14:94509439-94509461 TCCTGCAGCCTTCAGGTTCCAGG 0: 1
1: 1
2: 2
3: 36
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121510459 Original CRISPR CCGAAAAAGGACTAGGAGGC TGG (reversed) Intronic
904980644 1:34498210-34498232 CCAAAATAGGGCAAGGAGGCTGG - Intergenic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
908278197 1:62499096-62499118 TCCAAAAAGGAATAGGTGGCTGG - Intronic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
918126503 1:181588644-181588666 CAGACAAAAGACTAGGAGACTGG - Intronic
919777485 1:201203709-201203731 CCAGAAAAGGAAGAGGAGGCGGG - Intronic
919801560 1:201357555-201357577 CCCAAAATGGACAGGGAGGCAGG - Intergenic
922660519 1:227425827-227425849 CAGATAAATGACTAGGAAGCAGG + Intergenic
1064043590 10:11990431-11990453 CTTAAAAAGGGTTAGGAGGCCGG + Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1069131351 10:64708070-64708092 CAGAACAAGGACTAGCAGGTTGG + Intergenic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1074829697 10:117240351-117240373 CAGAGAAAGGGCTAGGGGGCGGG - Intergenic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1086578698 11:88371022-88371044 AAGAAAAAGAACTTGGAGGCAGG - Intergenic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1086957494 11:92948704-92948726 CAGAAAGAGGACTAGTAGGGGGG + Intergenic
1088080519 11:105906459-105906481 CCGAAGAAAGGCTTGGAGGCAGG + Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088733864 11:112709080-112709102 CCAAGCAAGGACTAGGAAGCTGG - Intergenic
1089091979 11:115885812-115885834 CTGAAAGAGGACTCAGAGGCCGG - Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1091224859 11:133951158-133951180 CCCAGAAAGGACGAGGCGGCGGG + Intronic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097990360 12:65825970-65825992 CCCAAAAAGGACCAGGCAGCCGG - Intronic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1100254684 12:92871003-92871025 TAGAAAAAGGACTTTGAGGCTGG - Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1104024977 12:125019152-125019174 GCTAAAAAGGAGTAGAAGGCCGG - Intronic
1104220625 12:126781315-126781337 ACGAGATAGGACTAGGAGCCAGG + Intergenic
1104448035 12:128848602-128848624 GCGAAAAAGGTGGAGGAGGCTGG + Intergenic
1104625612 12:130351696-130351718 ACAAAAGAGTACTAGGAGGCAGG - Intronic
1107735064 13:43390843-43390865 CCGAAAAAGGGAAGGGAGGCAGG - Intronic
1113453863 13:110433282-110433304 CAGAAATAGGACCAGGCGGCCGG + Intronic
1115698654 14:35926431-35926453 CTTAAAAAGGGCTAGGATGCGGG - Intronic
1115731698 14:36276236-36276258 CAGGAAAAGGACTAGGACGTGGG - Intergenic
1118035977 14:61866296-61866318 CCAAAAAAGGAAGAGGAGGGTGG + Intergenic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1123212786 14:106776738-106776760 GCGGAAAATGACTGGGAGGCAGG - Intergenic
1124564035 15:30798809-30798831 TCCAAAAAGGGCTGGGAGGCAGG + Intergenic
1125126740 15:36232368-36232390 CCAAGAAAGAAGTAGGAGGCAGG + Intergenic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125906775 15:43400256-43400278 CGGAAAAACGTCTAGGAGGTTGG + Intronic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1131282699 15:91033972-91033994 TCGAAGAAGGGCTAGGAGGCGGG - Intergenic
1134120545 16:11581059-11581081 ACGAAAAAGGAATAAGCGGCTGG - Intronic
1135038235 16:19096328-19096350 GCGAGAAAGGAGTGGGAGGCTGG - Intergenic
1135353117 16:21746688-21746710 CCTAAAATGGACTAGAAGGATGG - Intronic
1135451604 16:22562811-22562833 CCTAAAATGGACTAGAAGGATGG - Intergenic
1136023063 16:27452225-27452247 TCGAAAAATGAATAGGAGGCTGG + Intergenic
1136736726 16:32473784-32473806 CCCAAATAGGACTAGGGGACGGG - Intergenic
1138165783 16:54800530-54800552 CCGAAAAAGGAATTGCAGGAAGG - Intergenic
1139656853 16:68393106-68393128 ATGAAAATGGACCAGGAGGCTGG + Intronic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1203016342 16_KI270728v1_random:355793-355815 CCCAAATAGGACTAGGGGACGGG + Intergenic
1203034677 16_KI270728v1_random:628951-628973 CCCAAATAGGACTAGGGGACGGG + Intergenic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143353881 17:6310074-6310096 CCCAGAAAGGACTAGGATCCTGG + Intergenic
1146759025 17:35460190-35460212 AAGGAAAAGGACTAGAAGGCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149645151 17:58235519-58235541 ACTAAAAAATACTAGGAGGCCGG + Intronic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1158111783 18:53947999-53948021 CCAAAAAAGGAATAATAGGCTGG + Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1161510278 19:4666766-4666788 CAGAAAAATCTCTAGGAGGCCGG + Intronic
1163803614 19:19383261-19383283 CCTCAAAAAGAATAGGAGGCTGG + Intergenic
928389394 2:30897606-30897628 CCACAAAAGGACCTGGAGGCGGG - Intergenic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
932203620 2:69856931-69856953 TCAAAAAACTACTAGGAGGCTGG - Intronic
936607324 2:113971644-113971666 CGGAAAGATGACTAGGAGTCTGG + Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
941037108 2:160580608-160580630 GCAAAAAAGGAATAAGAGGCAGG - Intergenic
941083105 2:161085546-161085568 GTGAAAAAGGACTGGCAGGCTGG + Intergenic
948095211 2:235327972-235327994 CAGAAAAAGGTCTTAGAGGCCGG + Intergenic
948930414 2:241128312-241128334 CCGAAAAAGAGAGAGGAGGCTGG + Intronic
949072444 2:242033675-242033697 CAGAAAATGGGCTAGGAGGAGGG - Intergenic
1170088155 20:12559709-12559731 CTTAAAAAGTACTATGAGGCCGG + Intergenic
1170204586 20:13784733-13784755 CCGAAAAAGGCTCAGGAGGAAGG + Intronic
1171100786 20:22381938-22381960 AGGCAAAAGGACGAGGAGGCTGG - Intergenic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173348184 20:42220413-42220435 CCAAAAAAGAACAGGGAGGCAGG + Intronic
1173594629 20:44250785-44250807 CCCACAAAGGAGGAGGAGGCTGG - Intronic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1177240034 21:18444124-18444146 CTGAAGTAGGACTACGAGGCTGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1181496141 22:23288523-23288545 CCCAGAAAGGACTAGGGGGCAGG - Intronic
1182541276 22:31043909-31043931 CCGAAAAAAGAAAAAGAGGCTGG + Intergenic
1183255728 22:36760645-36760667 TAGAAACAGGACTAGGAGTCAGG - Intronic
1184538778 22:45106177-45106199 AAGCAAAAGGACTGGGAGGCGGG + Intergenic
949980604 3:9499927-9499949 CGGAAAAAGGACTCGGGAGCGGG - Exonic
955469947 3:59276156-59276178 CCTATAAAGGACTAAGAGACTGG + Intergenic
959984433 3:112557039-112557061 CAGAAATAGGTCTAGAAGGCAGG + Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961083395 3:124045171-124045193 ACAAAAAAGGGCTAGGAGGAGGG + Intergenic
961602974 3:128075381-128075403 CCGGAAAGGGAACAGGAGGCAGG + Intronic
962976367 3:140449570-140449592 CCGTAAAAGGACTAAAAGGGAGG - Intronic
963312050 3:143720412-143720434 CAGAACTAGGACTATGAGGCTGG + Intronic
965823726 3:172710234-172710256 AAGAAAGAGGACTGGGAGGCTGG - Intronic
969240397 4:5893177-5893199 GCTACAAAGGACCAGGAGGCGGG + Intergenic
969273177 4:6116643-6116665 CAGACAAACGACTTGGAGGCTGG - Intronic
978023557 4:103844280-103844302 CCCTAAAAAGACTAGAAGGCTGG + Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
985322466 4:188730140-188730162 CCGCTAAAGGAGGAGGAGGCTGG + Intergenic
986104919 5:4650623-4650645 TCTAAAAAGGAATAGGATGCTGG + Intergenic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
989253454 5:39342006-39342028 CAGAAAAATGATTATGAGGCAGG - Intronic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
1002162583 5:177324449-177324471 CAGAAAACAGACTAAGAGGCTGG - Intergenic
1003559103 6:7166275-7166297 ACCAAAAATGACTAGCAGGCAGG - Intronic
1005290108 6:24371305-24371327 AAAAAAAAGAACTAGGAGGCTGG + Intergenic
1005516225 6:26556943-26556965 GCAAAAAAGGTTTAGGAGGCAGG + Intergenic
1006146078 6:31960495-31960517 CCCCATAAGGACTGGGAGGCTGG - Exonic
1008068787 6:47078686-47078708 TAGAAAAAGTACTCGGAGGCTGG + Intergenic
1013793669 6:113860376-113860398 GAGAAAAAGGCCGAGGAGGCCGG + Exonic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018605930 6:165597862-165597884 CAGAAAAAAGACTGTGAGGCTGG + Intronic
1022621803 7:31992056-31992078 CTGAAAAAGGACTTGGTTGCAGG + Intronic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029453226 7:100654482-100654504 TCAAAAAAGGACTTGGAGGCTGG + Intronic
1031109104 7:117584060-117584082 CCGATAAAGGACTAGTATCCAGG - Intronic
1031925315 7:127633067-127633089 GAGAGAAAGAACTAGGAGGCAGG - Intergenic
1035116141 7:156525855-156525877 CAGAAAAAGAATTATGAGGCTGG + Intergenic
1037682037 8:21105611-21105633 CCCAAAAAGCACAAGGAGCCAGG + Intergenic
1038349696 8:26764563-26764585 TGGAAAAAGGAGTCGGAGGCTGG + Intronic
1040051964 8:43023754-43023776 TCGAAAAGGAAATAGGAGGCTGG - Exonic
1044540537 8:93404163-93404185 CCTACAAGGGAATAGGAGGCAGG + Intergenic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1050826183 9:9949608-9949630 CCGTAGTAGGACTAGGAGCCTGG - Intronic
1050959857 9:11715451-11715473 CATAAAAAAGACTAGGAAGCAGG - Intergenic
1056820730 9:89840168-89840190 AGGAAAAGGGACTAGGAGGCAGG + Intergenic
1058364929 9:104197948-104197970 CTGAAAAATAACTAGGAGTCAGG + Intergenic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1190836135 X:54102323-54102345 CAGAAAATAGACTAAGAGGCAGG - Intronic
1190836870 X:54109322-54109344 CAGAAAATAGACTAAGAGGCAGG + Intronic
1191166607 X:57399030-57399052 CCGAGCATGGACTAGCAGGCCGG + Intronic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1195630689 X:107052592-107052614 CGGAACAAGGGCTAGCAGGCTGG + Intergenic