ID: 1121510697

View in Genome Browser
Species Human (GRCh38)
Location 14:94510923-94510945
Sequence CTTTGGGGACTCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2126
Summary {0: 2, 1: 28, 2: 199, 3: 616, 4: 1281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121510688_1121510697 29 Left 1121510688 14:94510871-94510893 CCCATAAGTGGGAGCTAAGCTGT 0: 4
1: 28
2: 58
3: 128
4: 281
Right 1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG 0: 2
1: 28
2: 199
3: 616
4: 1281
1121510689_1121510697 28 Left 1121510689 14:94510872-94510894 CCATAAGTGGGAGCTAAGCTGTG 0: 1
1: 18
2: 17
3: 44
4: 132
Right 1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG 0: 2
1: 28
2: 199
3: 616
4: 1281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121510697 Original CRISPR CTTTGGGGACTCAGGGAAGA AGG Intronic
Too many off-targets to display for this crispr