ID: 1121510753

View in Genome Browser
Species Human (GRCh38)
Location 14:94511572-94511594
Sequence GTGGTGTCGGTTCCTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121510753_1121510761 22 Left 1121510753 14:94511572-94511594 CCCAGAACAGGAACCGACACCAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1121510761 14:94511617-94511639 CATTCGACTTCTCCTTTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 86
1121510753_1121510759 18 Left 1121510753 14:94511572-94511594 CCCAGAACAGGAACCGACACCAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121510753 Original CRISPR GTGGTGTCGGTTCCTGTTCT GGG (reversed) Intronic