ID: 1121510753

View in Genome Browser
Species Human (GRCh38)
Location 14:94511572-94511594
Sequence GTGGTGTCGGTTCCTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121510753_1121510759 18 Left 1121510753 14:94511572-94511594 CCCAGAACAGGAACCGACACCAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71
1121510753_1121510761 22 Left 1121510753 14:94511572-94511594 CCCAGAACAGGAACCGACACCAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1121510761 14:94511617-94511639 CATTCGACTTCTCCTTTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121510753 Original CRISPR GTGGTGTCGGTTCCTGTTCT GGG (reversed) Intronic
900558018 1:3289775-3289797 GTGGTGTCGGCTCTAGTTCCAGG + Intronic
900975388 1:6013191-6013213 GAGGTGTCAGTTCCTGTTCCGGG + Intronic
901798635 1:11694435-11694457 GTGGTCTCTGTGCCTGTTATAGG + Intronic
902969789 1:20038989-20039011 GTGGTGTGGGTTCCAGGTGTAGG + Intronic
906175549 1:43768550-43768572 GTGGTCTCCCTTCCTGTTCCTGG - Intronic
914968269 1:152281170-152281192 GTTGTGTCCTTTCCTGTTATTGG - Intergenic
915640758 1:157224094-157224116 GTGGTGACAGTTACTGCTCTAGG + Intergenic
918653636 1:186997437-186997459 GTGGTGTCAGTGGCTGTTTTAGG + Intergenic
921760212 1:218904651-218904673 CTGATGTTGCTTCCTGTTCTTGG - Intergenic
923136494 1:231124653-231124675 GTGTTGTGGCCTCCTGTTCTGGG + Intergenic
924274912 1:242375922-242375944 GAGTTGGCGTTTCCTGTTCTGGG - Intronic
1063351675 10:5362509-5362531 TTGGTGTTGGTGGCTGTTCTTGG - Intergenic
1063773098 10:9226860-9226882 GTGGTGTCGGGTACTGTCTTAGG + Intergenic
1068078751 10:52292066-52292088 GAAGTGTCGGTTCATGTCCTTGG + Intronic
1076143552 10:128098310-128098332 CTGGTGTCACTTCCTGTACTGGG + Exonic
1079937873 11:26640432-26640454 GTGGTGTTCCTTCCTATTCTTGG + Intronic
1080403797 11:31960573-31960595 GCGGTGTGGCTTCCTGTGCTAGG + Intronic
1082954713 11:58857532-58857554 GTGGTAACGGTTCCCGCTCTGGG - Intronic
1089743204 11:120599342-120599364 GTGGGGAAGGTCCCTGTTCTGGG + Intronic
1090039984 11:123282257-123282279 GTGGTCTCTGTGCCTGCTCTCGG - Intergenic
1090477557 11:127037275-127037297 GTGGTGGCTGTTCCTGGCCTTGG + Intergenic
1094597497 12:31878428-31878450 GTGTTTTATGTTCCTGTTCTAGG + Intergenic
1103843379 12:123883847-123883869 GTTTTGTCCGTGCCTGTTCTGGG + Intronic
1105569918 13:21592533-21592555 GTTGTGTCTTTTCCTGATCTTGG - Intronic
1106901327 13:34357453-34357475 GATGTGTCACTTCCTGTTCTCGG - Intergenic
1112184201 13:97112489-97112511 GTGTTGTCGTTGCCTGTTGTTGG + Intergenic
1117065590 14:52010710-52010732 GAGGTGTCAGGACCTGTTCTAGG - Intronic
1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG + Intergenic
1121510753 14:94511572-94511594 GTGGTGTCGGTTCCTGTTCTGGG - Intronic
1122705367 14:103617455-103617477 GTGGTGCTGGTTCCTGAGCTCGG - Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1128540486 15:68525634-68525656 GGGGTTTTGGTTTCTGTTCTGGG - Intergenic
1130312646 15:82768553-82768575 GTGGTGTCAGGTCCTGTGCAAGG - Intronic
1130987303 15:88852965-88852987 GTGGTGTCAGGTGCTCTTCTGGG + Intronic
1132092094 15:98955346-98955368 AGGGTGCAGGTTCCTGTTCTGGG - Intronic
1132570126 16:640925-640947 GTGCTGTGGGTCTCTGTTCTGGG - Intronic
1136030991 16:27502995-27503017 GTGCTTTCGGTCTCTGTTCTAGG - Exonic
1137565551 16:49530524-49530546 CTGGTGCCAGATCCTGTTCTAGG - Intronic
1138452059 16:57099054-57099076 GTCGTGTCTGTTTCTGATCTGGG - Intronic
1142322778 16:89395125-89395147 GTGGTGGTGTTGCCTGTTCTTGG - Intronic
1143591276 17:7886821-7886843 GTGGTGTGGGTCCCGGATCTGGG + Intronic
1144676278 17:17164254-17164276 GTGGTGCCGGATCGTGTCCTTGG - Intronic
1146817000 17:35950340-35950362 GAGGTGACCCTTCCTGTTCTGGG + Intergenic
1148359284 17:46998553-46998575 GAGGTGACCCTTCCTGTTCTGGG - Intronic
1150787408 17:68174186-68174208 GAGGTGACCCTTCCTGTTCTGGG + Intergenic
1152577807 17:81150537-81150559 GTGGAGACAGTCCCTGTTCTGGG - Intronic
1152997857 18:425003-425025 GAGGTGTGGTTTCCTGTACTTGG + Intronic
1153326061 18:3821606-3821628 GTGTTGTTGTTTCCTGGTCTGGG + Intronic
1155980801 18:32177497-32177519 GTGGTGTTCTTTCGTGTTCTGGG + Intronic
1158552632 18:58449551-58449573 GAGGTGGCGATTTCTGTTCTAGG + Intergenic
1158615783 18:58985443-58985465 GAGTTGGCGTTTCCTGTTCTGGG + Exonic
1160582264 18:79890428-79890450 GTGCTGTCGGGTGCTGTGCTTGG - Intronic
1163708517 19:18831951-18831973 GTGGCGGCAGTTCCTGCTCTAGG + Exonic
1164607677 19:29611685-29611707 GAGGTGTAGGTTCTTGGTCTCGG + Intronic
926129717 2:10295168-10295190 CTGATGATGGTTCCTGTTCTGGG - Intergenic
926952891 2:18262728-18262750 GAGTTGGCGTTTCCTGTTCTGGG + Intronic
927105356 2:19819129-19819151 CTGGTGTCTGGTCCTGTTCTTGG - Intergenic
927688618 2:25191278-25191300 TTGGTGCCAGGTCCTGTTCTAGG + Intergenic
928102541 2:28447678-28447700 GTGGTCGAGGTGCCTGTTCTGGG - Intergenic
935712039 2:105908099-105908121 GAGATGTTGGTTCCTGTGCTAGG + Intergenic
936150015 2:110011766-110011788 GAGTTGGCGTTTCCTGTTCTGGG + Intergenic
936194661 2:110359604-110359626 GAGTTGGCGTTTCCTGTTCTGGG - Intergenic
937354806 2:121191594-121191616 GTGGAGTCATTTCGTGTTCTAGG + Intergenic
937719109 2:125071231-125071253 TTGTTGTTGCTTCCTGTTCTGGG - Intergenic
938569942 2:132553746-132553768 GTGGTCTGGGTTCAGGTTCTAGG - Intronic
942487432 2:176454167-176454189 GTGGTATCTGTCACTGTTCTAGG - Intergenic
945197988 2:207255268-207255290 GTGGTGTCTGTTGCAGTCCTGGG - Intergenic
1169534269 20:6520626-6520648 CTGGTGTGGGTTCCTCTACTTGG - Intergenic
1169534528 20:6524110-6524132 CTGGTGTGGGTTCCTCTACTTGG + Intergenic
1172779667 20:37428720-37428742 GTGGTGTCAGTTACTGATGTGGG - Intergenic
1175868352 20:62193681-62193703 GTGGTTTCGGGTCCTCCTCTGGG + Intronic
1177956811 21:27607691-27607713 GAGGTGTCTGTTCATGTCCTTGG + Intergenic
1180582734 22:16856609-16856631 GAGTTGGCGTTTCCTGTTCTGGG - Intergenic
1181677198 22:24463175-24463197 CTGGTGTCTCTTCCTCTTCTTGG - Intergenic
1182518101 22:30870286-30870308 ATGGTGCCCGTTCCTGTTCCTGG - Intronic
1184002088 22:41682462-41682484 GTGGCGTCACTTCCTGCTCTTGG - Exonic
950270826 3:11613540-11613562 GTGGTCCCGGGTACTGTTCTGGG + Intronic
951093039 3:18597744-18597766 GTGGTGTCTGTGGCTTTTCTAGG + Intergenic
953312789 3:41896156-41896178 GGGGTGTCGGTTCCTTTACTGGG - Intronic
953725634 3:45395409-45395431 GTGCTCTCTGTTCCTTTTCTGGG + Intronic
954492120 3:50916105-50916127 ATGGTGTCGGCTCCTTCTCTGGG + Intronic
967320175 3:188187288-188187310 GTGGTTTCATTTCCTTTTCTGGG + Intronic
970221576 4:13817433-13817455 GAGGTGTTGATTCCTGTTCAAGG + Intergenic
971758374 4:30732656-30732678 GAGGTGTGTGTTTCTGTTCTCGG + Exonic
975030644 4:69610680-69610702 CTGGTGTCACTTCCTCTTCTTGG - Intronic
980411567 4:132426218-132426240 GAGGTGTCTGTTCATGTCCTTGG + Intergenic
981631542 4:146824572-146824594 GTGGTGTCTTTTCCTGATTTTGG + Intronic
982702451 4:158671831-158671853 TTGGTGTCGGTTCGGCTTCTCGG - Exonic
983013710 4:162582289-162582311 TTGATGTCCGTTCCTGTTTTGGG + Intergenic
985137074 4:186796914-186796936 GTGTTGTGGGTTCCTGTACAAGG + Intergenic
989262450 5:39433347-39433369 GTGGTGACGTTTCCTTCTCTGGG - Intronic
990003764 5:50922646-50922668 CTGCGGTCCGTTCCTGTTCTTGG - Intergenic
992769186 5:80031233-80031255 GTGGTGAGGGTTCCTGTACATGG + Intronic
994731586 5:103498322-103498344 TTGGTGTGGTTTCCTGTTCCGGG - Intergenic
999321424 5:150617681-150617703 GTGGTGTAGGTACCTTTGCTGGG + Intronic
1001932696 5:175684396-175684418 GTGGTGCTGGTTTATGTTCTAGG + Intronic
1005959129 6:30683934-30683956 GTGGGGTGGGTTTGTGTTCTAGG - Intronic
1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG + Exonic
1007784367 6:44271277-44271299 GTGGTGGTGGTACCTGATCTGGG + Intronic
1007904061 6:45441207-45441229 GTACTATCGGTTCCTGTTGTTGG + Intronic
1010159652 6:72838113-72838135 CTGGTGTCGGGGCCTGTTGTGGG - Intronic
1010590356 6:77705137-77705159 GTGTTGTTGATTCTTGTTCTAGG + Intronic
1011476813 6:87756371-87756393 TTGGAGTGGGTCCCTGTTCTTGG + Intergenic
1019329145 7:454184-454206 GTGGTGGGCGTTCCTGTGCTGGG - Intergenic
1022201606 7:28122697-28122719 GTGGTGTTGGTTGGTGTTCCGGG - Intronic
1027401678 7:77815126-77815148 GTGGTGTAGTGTCCTGTTTTTGG - Intronic
1027980945 7:85221077-85221099 GTTTTGTCTGTTTCTGTTCTGGG - Intergenic
1029158413 7:98533689-98533711 TTGGTGTCTGGTACTGTTCTAGG + Intergenic
1032315245 7:130831747-130831769 GTTTTGTCTGTTCCTGTTCTGGG + Intergenic
1033181527 7:139184117-139184139 GTGGTGAAGGTTCCTGTGCATGG - Intronic
1033948638 7:146755214-146755236 GTGTTGTCGGTTACTTTGCTGGG + Intronic
1035335109 7:158122949-158122971 GTCATGGCGGGTCCTGTTCTTGG - Intronic
1037446809 8:18973486-18973508 CTGGTGTCTCTTCCTCTTCTTGG + Intronic
1037919234 8:22792451-22792473 GTGGTATCGGTCCGTGTCCTTGG + Intronic
1041957977 8:63577541-63577563 GTGCTGTCGGTTGCTCTCCTGGG + Intergenic
1056599705 9:88036997-88037019 GTGGTGTTGGATCCTGTTGGGGG + Intergenic
1056650842 9:88460625-88460647 GTGGTGTCAGTTCCAGTCCAAGG + Intronic
1058331408 9:103765640-103765662 GAGTTGGCGTTTCCTGTTCTGGG + Intergenic
1059669710 9:116480467-116480489 TTAGTGTCAGTTACTGTTCTAGG + Intronic
1189355394 X:40306569-40306591 GTGGTATCGATTACTGTGCTAGG + Intergenic
1192799515 X:74452290-74452312 GTCTTGTCCGTTCCCGTTCTAGG + Intronic
1200906293 Y:8486021-8486043 GTAGGGTCTGTTCCTGTTATGGG - Intergenic