ID: 1121510759

View in Genome Browser
Species Human (GRCh38)
Location 14:94511613-94511635
Sequence GAGCCATTCGACTTCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121510756_1121510759 -1 Left 1121510756 14:94511591-94511613 CCACCTTCAGTTTTCCATCTCTG 0: 1
1: 0
2: 2
3: 55
4: 460
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71
1121510753_1121510759 18 Left 1121510753 14:94511572-94511594 CCCAGAACAGGAACCGACACCAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71
1121510757_1121510759 -4 Left 1121510757 14:94511594-94511616 CCTTCAGTTTTCCATCTCTGAGC 0: 1
1: 0
2: 3
3: 43
4: 291
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71
1121510754_1121510759 17 Left 1121510754 14:94511573-94511595 CCAGAACAGGAACCGACACCACC 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71
1121510755_1121510759 5 Left 1121510755 14:94511585-94511607 CCGACACCACCTTCAGTTTTCCA 0: 1
1: 0
2: 0
3: 30
4: 258
Right 1121510759 14:94511613-94511635 GAGCCATTCGACTTCTCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121510759 Original CRISPR GAGCCATTCGACTTCTCCTT TGG Intronic