ID: 1121510760

View in Genome Browser
Species Human (GRCh38)
Location 14:94511616-94511638
Sequence CTTCCAAAGGAGAAGTCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121510760 Original CRISPR CTTCCAAAGGAGAAGTCGAA TGG (reversed) Intronic
907090646 1:51721827-51721849 CTTCCACAGGTAAAGTGGAATGG + Intronic
909044087 1:70688147-70688169 CTTCAAAATGAGAAGTCGTTGGG - Intergenic
909354098 1:74687186-74687208 CTTGCATAGGAGAAGCCGGATGG - Intergenic
909738012 1:78990545-78990567 TTTTCAAAGGAGAAGTATAAAGG + Intronic
909984599 1:82145046-82145068 TTATCAAAGGAAAAGTCGAAAGG + Intergenic
910553249 1:88500427-88500449 CTGCCAAAGGAGAGGTAGAAGGG + Intergenic
913424938 1:118717991-118718013 CTCCTAAAGGAGAAGCTGAAAGG + Intergenic
913457957 1:119053048-119053070 CTCCCACAGGAGAAGTCACAAGG + Intronic
915004142 1:152621309-152621331 CATCCAAAGGATAAGTCCCATGG + Intergenic
915805301 1:158842397-158842419 CTTCGAAAAGAGAAGTCAAAAGG + Exonic
919276023 1:195417742-195417764 CTTCCAAGGGAGAAGTTACAAGG + Intergenic
919706325 1:200679639-200679661 CACCCAATGGAGAAGTGGAAAGG - Intergenic
920831059 1:209466169-209466191 CTTTCAAAGGAGAAACAGAATGG + Intergenic
921366155 1:214376358-214376380 ATTCCAAAGAAAAAGGCGAATGG - Exonic
1063496514 10:6514273-6514295 TTTCCAAAGGAAAAGTAGGAGGG - Intronic
1064965038 10:21006646-21006668 TTTCCAAAGGAGGAGTTGCATGG + Intronic
1065873428 10:29976074-29976096 TTTCCAAATGAAAAGTTGAAAGG + Intergenic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1071111886 10:82168310-82168332 CTTCCAAGAGAGAAGCCAAATGG - Intronic
1071129239 10:82372132-82372154 CTTCCAAATGAGAAATAAAAAGG - Intronic
1074049272 10:109867573-109867595 CTTCCACAGGAGCTGTGGAATGG - Intronic
1077461724 11:2714186-2714208 CATCCACAGGATAAGTCAAATGG + Intronic
1077805936 11:5591076-5591098 CTTCAAAAGGAGAAATTAAAAGG + Intronic
1081795631 11:45817396-45817418 CTTCAAAAGCAGAAGTGAAAGGG - Intergenic
1083644874 11:64166265-64166287 CGGCCACGGGAGAAGTCGAAGGG - Intergenic
1084388017 11:68856128-68856150 CTTCCAGAGGGGGAGTGGAAGGG - Intergenic
1085274872 11:75291944-75291966 CTTCCAGAAGAGAAGGCGAGTGG + Intronic
1086179536 11:83933854-83933876 CTTCCATAGGAGAATCCAAATGG - Intronic
1087700383 11:101430627-101430649 CTTCCAAAGGAGAAATTAAGGGG - Intergenic
1088065875 11:105718781-105718803 CTGCCAAGGGAGCAGTGGAATGG - Intronic
1089073448 11:115718290-115718312 CTGCCCAAGGGGAAGTCGCAAGG + Intergenic
1090638270 11:128707302-128707324 CTTATTATGGAGAAGTCGAAGGG - Intronic
1091668428 12:2435713-2435735 CCTCCAGAGTAGAAGTTGAAGGG - Intronic
1092305827 12:7299693-7299715 CTTCCAAAAGAAAAGAAGAAAGG + Intergenic
1092554953 12:9548583-9548605 CTTCAAAAGGTGAAATCCAAAGG - Intergenic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1105704905 13:22962637-22962659 CCACCGAGGGAGAAGTCGAAGGG - Intergenic
1107229413 13:38089957-38089979 CATCCAAAGGAGAAGTAAATGGG - Intergenic
1109923967 13:69109515-69109537 CCTCTAAAGGAGAAGTAGAGAGG - Intergenic
1110040364 13:70747798-70747820 CCTCCAACGGAGAAGTGAAAGGG + Intergenic
1111112275 13:83729180-83729202 TTTCCAAAGGAAAAGTACAATGG + Intergenic
1114700474 14:24673193-24673215 GTTTCACAGGAGAAGTGGAAAGG + Intergenic
1115197713 14:30819562-30819584 ATCCCAAAGGAGAAGGGGAAGGG - Intergenic
1118444779 14:65841139-65841161 CTTCCAAAGAAGAAACAGAAAGG + Intergenic
1118878481 14:69805461-69805483 TTTCCAAATGAAAAGTTGAAAGG + Intergenic
1120547833 14:85831483-85831505 GTTCCAAAAGAGAATTGGAAAGG - Intergenic
1121510760 14:94511616-94511638 CTTCCAAAGGAGAAGTCGAATGG - Intronic
1124894935 15:33767588-33767610 CTTCCATAGGACAACTCAAATGG - Intronic
1125383537 15:39112921-39112943 CTTCCATAGGGAAAGTCTAAAGG + Intergenic
1127334363 15:57969032-57969054 CTTCCAAAGATGAAGGGGAAAGG - Intronic
1127726005 15:61750826-61750848 CTTCCGAATGTGAAGTCGAGTGG + Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129910801 15:79224553-79224575 CTGCCAAAGGGGAAGCAGAATGG - Intergenic
1130368017 15:83257945-83257967 CTTCAAAGGAACAAGTCGAATGG - Exonic
1131652643 15:94418238-94418260 CCTCCATGGGAGAAGTCCAATGG - Intronic
1132194718 15:99904858-99904880 CTCCAAAAGGAGAATTCGAAAGG + Intergenic
1135207833 16:20498021-20498043 CATCCAAAGGAGAAGTAAACAGG + Intergenic
1135211066 16:20525679-20525701 CATCCAAAGGAGAAGTAAACAGG - Intergenic
1139197783 16:64940993-64941015 TCTTCAAAGGAGAAGCCGAAAGG + Intergenic
1139367147 16:66440533-66440555 CTGCCAAAGGAGACCACGAATGG - Intronic
1139915060 16:70422975-70422997 CTTCCAAAGGAGGAGACAGAGGG + Intronic
1142960381 17:3548727-3548749 CTTCCAAAAGGGAAGACAAAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144070411 17:11666521-11666543 CGTTCGAAGGAGAATTCGAAGGG - Intronic
1146631066 17:34469690-34469712 CTTCCAAAGGAGAGGCACAAAGG - Intergenic
1146665571 17:34700528-34700550 CTTCCACAGGAGAAGTAGTGTGG + Intergenic
1150240902 17:63631794-63631816 CTTCCCATGGGGAAGTCAAAGGG - Intronic
1150567345 17:66353403-66353425 CTTTCAAAACAGAAGTCGGAAGG - Intronic
1152989975 18:354469-354491 CCTCTGAAGGAGAAATCGAAAGG - Intronic
1153000128 18:447357-447379 CTGCCACAGGGGAAGTGGAAGGG - Intronic
1153967789 18:10197256-10197278 CCTCCCGAGGAGAAGTGGAAGGG + Intergenic
1157067629 18:44370354-44370376 CTTCCAAAGGACAAGAGAAAAGG - Intergenic
1161876290 19:6913537-6913559 CATCCAAAGGAGAATTAAAAGGG - Intronic
928925494 2:36574926-36574948 CTTCAAACGGAGAATTGGAAAGG + Intronic
930068415 2:47345449-47345471 GATCCAAAGGAGAAGTGGGAGGG - Intronic
935337312 2:102028426-102028448 CTTCCATAAGAGAAGACGTACGG - Exonic
935573788 2:104688580-104688602 CTACCCCAGGAGAAGACGAATGG - Intergenic
936623042 2:114120002-114120024 CTTCCCAAGGAGGAGTGGCAGGG + Intergenic
940218645 2:151327774-151327796 CTTCCAAAGGGTAAGTCTTATGG - Intergenic
941202489 2:162529094-162529116 CTTCTAAAGGAGATGTCTAGTGG + Intronic
942052198 2:172150321-172150343 CTATCACAGGAGAAGTCAAAGGG - Intergenic
945883321 2:215349372-215349394 CACCCAATGGAGAAGTCAAATGG - Intronic
947958847 2:234217787-234217809 CTTCCACCTGAGAAGTAGAAAGG + Intergenic
1169562862 20:6820743-6820765 CTTCCAAAGGAGACTTGGAATGG - Intergenic
1169611079 20:7380783-7380805 CTTCCAAAGGATCAGTTGACAGG - Intergenic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1180065487 21:45410150-45410172 CTTCCACAGGAGCCGTGGAAAGG + Intronic
1180703676 22:17795816-17795838 TTTCAAAAGAAGAAGTGGAAGGG + Intronic
1182687079 22:32129448-32129470 CTTCCAAGGGAGAAGATGAAGGG - Intergenic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
951699968 3:25486394-25486416 CTACCCAAGTAGAAGTCCAAAGG - Intronic
952086706 3:29831259-29831281 CCTCAAAAGGAGAATTCGATTGG - Intronic
957540833 3:81566822-81566844 GTTCCAAAGCACAAGTGGAAAGG - Intronic
961364639 3:126391418-126391440 TTTCAAAAGGAGAAGAAGAAAGG - Intergenic
962028707 3:131575827-131575849 CTTCCAGAGTAGAGGTCAAAAGG - Intronic
964900408 3:161652556-161652578 TTTACAAATGAGAAGTCGGAAGG + Intergenic
966705204 3:182906217-182906239 TTTCAAAAGGAGAAGTAAAAAGG - Intronic
969420871 4:7095053-7095075 CTTTCAAAGGAAAATTCCAAAGG + Intergenic
971772494 4:30915368-30915390 CTTCTAAAGGATAAATCCAATGG + Intronic
972382570 4:38533169-38533191 CTTCCAAAGGACAATACAAAAGG - Intergenic
975152958 4:71040988-71041010 CTTCCAAAACAGAAGTCAATAGG - Intergenic
977044626 4:92053084-92053106 CTTCCAAAGGTGAAGGATAAAGG + Intergenic
978728377 4:111997312-111997334 CTTCTAAAGTATAAGTTGAAGGG + Intergenic
979826621 4:125243831-125243853 CCTCCAAAGGACAAGAAGAATGG - Intergenic
985624221 5:976814-976836 CTTTCAAAGGAGAATTCAAACGG - Intergenic
993086973 5:83375142-83375164 CTTCCAAAAAAGAGGTTGAATGG - Intergenic
993186646 5:84630437-84630459 TTTCCAAAAGAGAAGACCAATGG + Intergenic
994600885 5:101903497-101903519 CCTCAAAAGGAGAAGTCCACAGG + Intergenic
996078144 5:119222478-119222500 CTTTTAAAGGAGAACTCAAAGGG + Intronic
996545217 5:124670917-124670939 TTTCCAAAGGAGAAGGGGAGGGG - Intronic
996629722 5:125612893-125612915 CTTCAAAAGGAGCAGATGAATGG + Intergenic
996970581 5:129362133-129362155 CCTCAAAAGGAAAAGTGGAAAGG - Intergenic
1002331398 5:178443293-178443315 CTTCCAGAGTAGAAGTCGTTCGG - Intronic
1002872925 6:1183739-1183761 CTTATAAAGGATAAGTCCAAAGG - Intergenic
1003038669 6:2667472-2667494 CTTCCAAAGGCATAGTCTAATGG + Exonic
1003780421 6:9418393-9418415 ATTCCAAAAGAAAAGTAGAAAGG - Intergenic
1004553845 6:16675938-16675960 CTGCCAAAGGAGAAGCGGACAGG + Intronic
1004878395 6:19979470-19979492 CTGTCAAAGGTGAAGTAGAAAGG - Intergenic
1008660999 6:53667763-53667785 CTACCATAGCAGTAGTCGAATGG - Intergenic
1009729234 6:67578575-67578597 CTTCCTAAAGAGTAGTTGAATGG + Intergenic
1018124806 6:160671322-160671344 CCTCCAAAGAAGAAGTCTATTGG + Intergenic
1028980632 7:96964216-96964238 CTCCCAAAGGAGAAAAAGAATGG - Intergenic
1034951606 7:155300644-155300666 ATTCCAAAAGAGAAGTAAAATGG - Intronic
1040859513 8:51984469-51984491 TTTCCAAACCAGAAGTGGAAGGG + Intergenic
1046677688 8:117129463-117129485 CTTCCATAGGAAAAGTTCAAGGG + Intronic
1046798313 8:118396681-118396703 CTTCCTAAGTAGAAGTAGCATGG - Intronic
1047120919 8:121903810-121903832 CTTCCAAAGGAGAAACTGATAGG + Intergenic
1048731597 8:137447907-137447929 CTTCCAAAGGAGAGTTGGAAGGG + Intergenic
1054972173 9:71100773-71100795 CTTGCAAAGGAGAAGTCTAATGG - Intronic
1057837504 9:98457145-98457167 AATCCAAAAGAGAAGTCAAAGGG - Intronic
1059635478 9:116166213-116166235 CTTCCAAAACAGAAGGGGAAGGG + Intronic
1185815136 X:3147758-3147780 CTTCCAAAGTGGATGTAGAAGGG + Intergenic
1191151993 X:57229018-57229040 CTTCCATAGCAGAACTGGAAGGG - Intergenic
1192017318 X:67345715-67345737 CTTCCAGAGGAGAGGAAGAAAGG - Intergenic
1195274518 X:103268501-103268523 CTTCCTAGGGAGCAGTAGAAAGG - Intergenic
1196826626 X:119745714-119745736 CTACCAAAGGAGAAATGTAAAGG + Intergenic
1197242228 X:124132524-124132546 CTTCCAAAGGATAAGGCCAAAGG + Intronic
1198688250 X:139250809-139250831 CTTCAAGAGGAGAAGTAGACAGG + Intergenic