ID: 1121513993

View in Genome Browser
Species Human (GRCh38)
Location 14:94536843-94536865
Sequence GGGCAGTTTAGTGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121513990_1121513993 2 Left 1121513990 14:94536818-94536840 CCAACTTCAATTACACGCAAATT No data
Right 1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121513993 Original CRISPR GGGCAGTTTAGTGCAAATTG AGG Intergenic
No off target data available for this crispr