ID: 1121514838

View in Genome Browser
Species Human (GRCh38)
Location 14:94542704-94542726
Sequence TTGGTAGTCCCTGACCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121514838_1121514842 21 Left 1121514838 14:94542704-94542726 CCCTGAAGGTCAGGGACTACCAA No data
Right 1121514842 14:94542748-94542770 CAGAAAGTGCTTCCTGAAGAAGG No data
1121514838_1121514843 24 Left 1121514838 14:94542704-94542726 CCCTGAAGGTCAGGGACTACCAA No data
Right 1121514843 14:94542751-94542773 AAAGTGCTTCCTGAAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121514838 Original CRISPR TTGGTAGTCCCTGACCTTCA GGG (reversed) Intergenic
No off target data available for this crispr