ID: 1121515325

View in Genome Browser
Species Human (GRCh38)
Location 14:94545764-94545786
Sequence TTCCATGGCAACGGGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121515319_1121515325 8 Left 1121515319 14:94545733-94545755 CCAGGGACCATCACTTTCTTTGC No data
Right 1121515325 14:94545764-94545786 TTCCATGGCAACGGGTGCTGTGG No data
1121515320_1121515325 1 Left 1121515320 14:94545740-94545762 CCATCACTTTCTTTGCAAGATGG No data
Right 1121515325 14:94545764-94545786 TTCCATGGCAACGGGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121515325 Original CRISPR TTCCATGGCAACGGGTGCTG TGG Intergenic
No off target data available for this crispr