ID: 1121515688

View in Genome Browser
Species Human (GRCh38)
Location 14:94548451-94548473
Sequence TGCAGTGCTGACCGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121515688_1121515699 21 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515699 14:94548495-94548517 GAAGCCTGGGGTGGGAAGGGCGG No data
1121515688_1121515691 -1 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515691 14:94548473-94548495 ACAGAGACGGCAGCGTAGGCAGG No data
1121515688_1121515693 8 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515693 14:94548482-94548504 GCAGCGTAGGCAGGAAGCCTGGG No data
1121515688_1121515697 17 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515697 14:94548491-94548513 GCAGGAAGCCTGGGGTGGGAAGG No data
1121515688_1121515692 7 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515692 14:94548481-94548503 GGCAGCGTAGGCAGGAAGCCTGG No data
1121515688_1121515690 -5 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515690 14:94548469-94548491 CTGCACAGAGACGGCAGCGTAGG No data
1121515688_1121515696 13 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515696 14:94548487-94548509 GTAGGCAGGAAGCCTGGGGTGGG No data
1121515688_1121515702 30 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515702 14:94548504-94548526 GGTGGGAAGGGCGGCAAGGCTGG No data
1121515688_1121515698 18 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515698 14:94548492-94548514 CAGGAAGCCTGGGGTGGGAAGGG No data
1121515688_1121515694 9 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515694 14:94548483-94548505 CAGCGTAGGCAGGAAGCCTGGGG No data
1121515688_1121515695 12 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515695 14:94548486-94548508 CGTAGGCAGGAAGCCTGGGGTGG No data
1121515688_1121515701 26 Left 1121515688 14:94548451-94548473 CCTGGACTTCGGTCAGCACTGCA No data
Right 1121515701 14:94548500-94548522 CTGGGGTGGGAAGGGCGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121515688 Original CRISPR TGCAGTGCTGACCGAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr